Description :
From Genome Similarity Track
Location :
Scaffold_1455:3353- 4463
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1455-fgenesh-gene-0.1GJ16446

Sequence
1110 bases(100 bases per row)
CGGACCACGCGCCGACGCCCAAGCGCTCGACCGAGCGGCGGCTGCGCAAGATGAGTCAGGAGTTCCCGCCCACCGCCTTCTCATTCCACGTGCAGGCGCG
CGTGCTCTGCGTGGGGCTGGCGGTCGTCTACCGCGTCGCGATCACGATCACCACGACCACCACGTGCGTGTCGTGCCAGTCGTGGGTCATCGCCATGAGC
CACGCCAAGTTCCGCACGTTCTACGCCCAGGTGCGCGCGATCCTGCAGCAGCACGAGCAGCAGCAGCCGAGCGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCACTTTGCGGACGTGTTG
GACAAGTACGAGCACCTGCACAGCGCGTTCGCAATCCACGCGGACATTGAGACCATGCACGAGGGCAAAGTGGCGCTCGAGGCCTTCCTCACTGACTGCT
GGAGCGCTCTGGAGCTCATCATCCCGTCGCTGGCCGTCGAGCCGCACGTGCCGGCGTCAGCGCTTGGGCGCGAAGTCCTGTGCATCTACGTGCTGCTGCG
CGACTTCCTTGCGTTCCCCGAGCGCATCCTGGAAGCCAACTGCGTCTACGCGAGCGCGATCCTGAGCCTGGAGGACGTCGAAGAGCTCCTGCCGACGCTC
TTGGAGCACGCGTGCAGCATCTGCCTCGAGTGGCTCACATGCGCAGACACGCGCGAGCTGGATCCTGACTCTGCAGCAGCATCAACAACAGCAGCAGCGT
CGACTGGTGACGACGCTGACGCGTGCGTGGCGACGGCGCGTGACGAGAGCCGCGCGTTCTCCGTGCGGCTGCCGTGCGCGCACGTCTTCCACGAAAACTG
CATCATGGCGTGGCTGCGGCACAACCCGACGTGCCCCGAGTGCCGCGCGACTGTCGGCGTCAAGCAATAGAGAGCATGGCAGACGCATGGCGACGACACA
TACATACATA