Description :
From Genome Similarity Track
Location :
Scaffold_97:335282- 336647
Sequence
1365 bases(100 bases per row)
TCAAGATCGGGCGAAGCGGCCCGGCGGTACACCCACTGATGTATGCTCGAGACCTCCCGTTTCAACTGGTTTAGGCGCCCCGCAAGACGAGCGACAACGC
ACTAATTCCCGCATGGGCGGCAGCATCACCGCCAGTCCGTAGGTCAAGTGCAATTTCAAGCACGAGGACGTGCTGACGGAGGCGGTCTACCTCAGAGCCT
TGCGTCGGACCCGCAGGTGAAGCACTCGGACGGGAGAAGCGCTCCAGAGGAGCCTGGTACTTGTACGCGTTCGAGGGCACCTCCTCCCCTGTTTGACCGG
AACGGAGAAGTCCACTACCACATGGAGCGGATTCTCCAGGAGCGGCGACTTTGCGGGAAGCGCCAGCTCCTCGTGGAGAGGAGAGGTTATGCCCACTCCG
AGAACTCGTTGAAACCGATTGAGCGTCTCCTGATAGATGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCT
TCTTGCCCGAACGGGGTACGGACGCTGTCAACACTCCGTACCCGCGCTCGTGAGCGCTAGAAGCCGCGCGCTTCAGAATGTCCCTTGGTAGCATGCGCTT
GCTGGCCAAGTGGGCGAACCGGACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGACCTTCATGGAGTTCCCATAACTTCGAGGGTGAGTAC
TTGATAGACTCAACCCACGCCCAGAACATGTCCTCACACGATTTTTATAGTTGGAACAGTTCTTGAGAAGAGCCCAGGGGTAGCCCCACAGAGAATAGAG
ACCACCCCAGTTCTCGGGCTACTTACGACAAGCCGTGAAGTCCTTCAGAGAGATTCGGTGCGGCGCAAGAAGCACGCACTGGGCCTCCTCCAGATTGTCG
ACGAACAACTGCTCCTTCTGGACCAGAGCACGTTCGTAAACGCCCTTAGAAGTGTGGCCACCAACAAGGCCACGACGAGCGACGAGGATATCCAGAAAGA
GGTCAGCCCCAAAGCTCTCCTCGGGAGGCCAATAACCTCTTGCGTTGATGGCAGCTCCCTGGTTAAGGGCGCCACCACCGGACCCCCACGCATGCGCTGG
GCAGCTTTGAAGTCCTCCTGCTGCTGGTCGAGAGCATTCGAGATCTCCCGGGGCTCATGAATAGCACATTTTTCTCTTCATCCGAGGAACCGAAGAGGTC
CCGATAGGAGTACCCAGTCTCGTTCACCTCGCGGAGTGGAGACTTCGAAGCCGTGCGCTTCTTATAGGCATTGGCGTCTTCGGATTTGGCGGCCTCAGCA
CGCGCAAGACCCTCGGCGAGCGAGAGATGTTTGAGAGGCTTCTCGTCGTCGTCGTCGCCAGCTTT