Description :
From Genome Similarity Track
Location :
contig_28:335217- 336573
Transcript NameFunction/comments
g5638.t1hypothetical protein PHYSODRAFT_320526
g5639.t1hypothetical protein PHYSODRAFT_320526

Sequence
1356 bases(100 bases per row)
GTTTCATCAAAAATCCAGTTCCCATACTGGATATTATCAAATCTTGATGATTTAGACCAATCAAATTAATGATTATCGGACGTATCAGATTCTTGTTCTT
ATCCTTGAATATCTTGCGCCATTCAGATATTGGTAGACATGCATACGAAAATTTATTGTTCAACCAGATTGGTTGTAGTTGCGGCAATACCTGCCGCTGA
CGGCAACTGCGTCACAGAATGCATCTACTTGCTGTGCTTGAGGAGCGGGCTCTTTATCATTCGGGGCTGACGCTCCAGACCTTGAGTAGCTGTTGCACGA
AATCCAGCACAACATTGGTTGTAAGTTTCAACTTTGTTGTAAAAAAGGTCTCTATTTCACATGTAAGCCATGCGCTCGAAAGCACGCTATCTCTTGACTG
GTTTCCGCGTACACTTGGCACTTACTTCTCGCGGCGCGAATCGTACTCGGCCTGGATCTCCTCGGCCGACTTGCCCGACGTCTCCGGCACCAGCTTCAGA
GCGAACAGGTAGAAGATCGCCAGCAGCACCACGAACGGCACGTACGCGTAGTCGGTCAGAGCATCCGAGATGTACGGGTACGACACGCCCACGATGAGGT
TGCACAGCCAGTTGATACCGATGCAGAAAGACGACGCGCTGGCACGGATCGAGTCCGGGAAAATGTCGGCCGTCATGACCCACACGAGCGGGCCAGTGTC
ACGCCGAACACGATCACGTACAGCGCCGTGAACACGATCGACAGCGCAGACACGTCCACGATGAAGGCCACCGTCATGCCGATGGACATAGCCACCATGC
CGGCCAGACCCCACAGGATCATGTTGCGCGCCCGAAGCGGTTGGCCAGCACGCCCGTGAAGAAGGCGGGCCAGATATTGATGAAGTCGATGATGAGCGTG
CCCACGCGCGAGTCCGAGATGCCGGCGTCCGAGAAGATGCTGCCGAGTAGTAGAAGACGGCGTTGATGCCCGAGAGCTGCTGCGCGCAGGACAAGAGAAC
GCCGCCCAGCAGCTGCAGACGGTAGCGCGGGTTGAACATCGACTCCTTCGCGGGAGCAGCCAGCCCCTCCTCGGCGTTCTCGGGCTTCTTGCTCATCTGC
AGCCACGACAGCGCAGTCTGCACATGCTGTTCGCCGTACAGACGGGCGATGACCTGCTTGGCTTCGTCCGTGCGGCCCTGGGTCAGTAGCCACGCCGGGC
TCTCCACGCACATCGTTGGCGCCAGCAGCAGGTAGGTCACTCCCAGGAGGACTGGGAACGCAGCCAGGTAGCGCCAGCCAGAGCTCGTGTTGGCGAAGAA
GAAGGCGATGGCCGGGAACAAAATGCCGATGGTCGTGAAGATCTGCAGCCCCAGGC