Description :
From Genome Similarity Track
Location :
Scaffold_50:335196- 340044
Sequence
4848 bases(100 bases per row)
GTGTAAGCAAGTAACGGAGTATATACCTGGCACGTTAAACCTGACAGTACTTCGAAGACCTTCCAACGACCAAGTTCGACATGAGCCAAGACCTCGACCA
CGCTGCCTTTCTCCATCTCACTCGAATCGAGTGGGAAGCTCTCCACCGCCTTGCGGCGGTGTCCGGAGAAGCCGTCGTCACGTCGCTGCTGCGCTCAGCG
ACGCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCATGGAACGCGAGCTCGCCGATGCGAATCGGCGAGTGTCAACTCCCTCGCGTATCTCCACGAATG
ACGTCGTGAAGCTAGAGACGTCCACCTACTCCGGTGCCGGAGGAGATCGACTTCCGCTGAATCGCTGGTTTCGAGAGATCGACATCGCCATCGCCTCGAG
GTTGATCGAGGCGCCTTCCGCGAAGGTCCGTTTCCTCCTCTCGCGGCTGTCTGGGAAAGCCAAGGAATGGGCTCTCGGCAAGTTGGTTGTCGATCCCAAC
GTCTTCCCCACTCTGGATACCCTCCAGAGTGACCTTCGGCTCGCGTTCGAGCTGCCGCAAGATGAATCCCGAATTCGGGCAGACTTCTTCGCCCTTCGGC
AAGGCACGATGACTATGCGCGACTACGTCCAGAAGACACGACACCTCGCGTCGTGCATCGTGTCTAAGCCGATCGATATGGCCTCTCAGGTTCATGTATT
CGTGTTCGGTATGCGCGAAGGCATGACGCGCTACTGCCTTACAAGATCGGACCCCTCTACGCTCGAAGAGGCATTCGCCCTCGCCCTACGCGAGGACTAC
GTGGTTGCGGCGTCATACGCTCACGCGCTACCTGCTTCTGCTCGGGATTCTGCGCCCGAGCCCATGGACATCGACGCTATCGATGCGACGAGCAATCGTC
AGCGTTATGCAGCGCGTCGGAGCGGTGCTCGGAACAATCGTTCTCTCACCTGCTTCCGCTGTCGGAAGGTCGGTCATCGCGCGGCGGAGTGCCGGGCGCC
AGCTCCAGTGCTTGCGCATGTCGATGCCGAGCCCGTGAGTTCTGACCAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATG
GAGGTCCGGGTCCCCCGGTGGCAACCCAACCTCCTAGCCCTCCTGTGCTGCATGCACACTTTCATGCCACCACCACGCCGAGCGATTCAAGATTGATCAT
CGCCAGTCTTCATGTCGCCGGTGCCCGGCGACCACTGCGAGCGCTCCTTGATTCAGGAGCGACCAACAACTTCTTCCGCGCGTCGTGCTTGTCGGTACTC
CCGTCGGACATCACTGTCCGCAAAGGTAGTGGGGAGGTCGCTGTCAAGTTGGCCGATGGGAAATCACGCCGCGTAGCGCGGCGCGAGATTACCCTTCCGT
ACACGTTCGACGGTTTCCGAAGCAACGACGACTTCCTCGTCATTGAGATGAATTACGCGTTTGACTGCATCCTGGGTATGCCGTGGCTGACGCGCTATCA
ACCAGAGATTGACTGGTTGGCCCGGTCGGTCAAGCGCCGCAGTGATTATGATGTGAGCGAGGTGTTCACGCACCTCCTGGTCGCCCAGAAGGATTGGCCT
CACGTCACCGTCGTGAACCGGTCATCCACGACGCACGTTGTGCACAGAGTGAGCGATGGCCCTCTCTGCACGGCTTGCGCAGTGCTGTTAACTGACGAGT
CCCCGCGGCGCCGCGGGGATGAAGACCAACTGGTGGTCGAGCAGGGGCTCCCGCAGATGTACGAGACGGCGGTCGAGCAGGGGCTCCCGCAGACGAATGA
GATGGCGGTCGAGCAGAAGCTCCCGCAGACGAACGAGATGGCGGTCGAGCAGGGGCTCCCGCAGACGAACGAGATGGCGGTCGAGCAGGGGCTCCCGTCA
ATTGAGCCGGTGGTCGAGCAGTTGGCGCTCCCGCTGAACACTACCGCGGTCGAGCAGGGGCTCCCGCTAGAGGGGGGTGACATCTCGTCCAGCGAGAGCG
ACTCATCATCCTCGAGTTCGCACTCGAGGCGGCGAAAGAGGAAGTCGAAGCGGCGTCGGCTGAAACCTCGCCGAGAGCCCGTACCAAGTGACAGCTCACC
GACGGAGTCGGTCTGCGTGCTTGAGTATGTGGAAGGTACCTCTGGCCGCCGACGAACACTCGAGCTTGCAAACCCGCCTGGCGAGGCAGGGTCGATCACT
CGACTTTCAGGTCTCTCCTGGAAGAACTTCCTTCGCGGCCTCAAGGACGATGAAATCGAACAGGTTTGCCTGATCACCGACGCCGATTCGGCGTCGCTCG
AAGTGAATGCAGTCAGTGACGGCGACGCTCCCTCGCGCCCAAAGAGCGCTGAGCCGAAGTCGGCCCGCGAGGAGCGCTTCGCAGCGCAGTCTTGGGACGC
GCTACGCGAATCCGGCAATCCAGTCTACGAGACCGCCCGCGAATATGAAGATGTATTTCCGGATAAGATCCCAGCTGAGTTGCCAGCTGACCGAGGAATT
CGCCACGAGATTGATCTCGTGCCCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCCGCGAGATCAGGTCCAAGCTATCGATGACTTCTTCGAGA
GCCGCCGCAAGGCGGGTCATGTGCGTGAGAGCACATCGCCGCACTCCAGTCCGACCTTCTGTGTGAAGAAAGCCACGGGCGGATGGCGCATCGTCCATGT
CTTCAACAAGCTAAACGACGCTACCATCCCTGCCCAGACGCCGATTCCTCGGAAGGACATGGTGCTCGACGCAATGTCGGGTAGTGAGGTCTTCAGCGCC
ATCGACTTGACCGATGGGTTCTACCAAATCCTCATGAGGCTGAGCAATATACCGCTCACAGCGGTAAGCACTCCCAGTGGTATGCTCTGGGAGTGGCTTG
TTATGCCGCAAGGGTTGAAGAATGCTCCCGCCACGTTCAATCGCATGGTATCCCATGTGCTGCGCCCGCTCCGCGACTTCGCACCGAGTTATTTTGATGA
CATCTTCGTACACAGTCGCGCTGAGGGAGGCCTCAGCGCGCTTGAAGTCCACTTGAAGCATCTGAGGCAAGTCTTCCAAGTGATGCGCGAAAACAAGCTG
TATGCCAACTTGAAGAAGTGTATATTCTGCGCGCCGGAGATTCCGGTGCTGGGCTGCTTTGTGAGCAAGAACGGCGTCCGCGCCGACCCCGAGAAAGTGT
CGTCGATATGTGCGTGGCCTACGCCACAGAATCCCACTGAACTGCGTCAGTGGCTGGGTCTCGCAAATTATCTCCACAAGTACACGAAGAATTACGCCGG
ATTGATCCAGCCGCTCTCTTCGTTGTTGAAGAAAGATGTGTCGTGGTCGTGGACTTCCGCACATCAAGCCGCCTTCGACTCGGTGAAGAAGAGTCTCGCC
GAGGCCCCAATCCTCGCGCTCCCGGATGACTCGAAGCCTTTTCACGTCGTCTGCGACGCGAGCGATTTCGCCATCGGCTGTGCGCTGATGCAATTCGATG
AAGAAGATCGAGAGCGTGTCGTAAGCTACCAGTCTAGGCAGATGAAGTCGGCGGAGCGCAACTACCCTGTTCACGACAAGGAGCTCCTTGCGATGCGCTA
CGCTCTGATCAAGTTCAGAGTGTACTTGTTGGGTGAGGATACCTTCGCGGTGTACACCGATCATGCATCGCTGAGGACAGCGATGAAGAGTCCTCATCTC
TCCCAGCTGATGGCCCGCTGGCTTTCGTTCTTCTCCGAGTACAACTTCGTTGTCCACTACAAACCCGGCAAGAACAACATTCTCGCCGACGCTTTGTCTC
GGCGTCCCGACTACGACCCACGCGGTGCATTGGGTCGACAAGCTTCGCTGGATGAAGACGATGTAGACGAGTGTGCCACGTGCGAGGCGTCAGGCGTCAA
CCTGACGAGCGTCTCCCCGGTAATGCCACTTCGCGACGAGATCCAAGCTGCTTACGAACATGACTCGACGTGCTCCAGTATCCTGAAGCATCTTTGCTCT
CCCAGCGCCGACACACTGGGAGCCCTTTCCCGCTCTGTACGAAACAAAATCCACCGATATCGTCTCGAGGACGAGCTGCTGGCGTACAGCATCGACAACT
TCGATGCCCCACGTGTCGTTGTCCCTAACGACCCCGATCTGCGCTCACGGATTATCCATGAGTTTCATGATGCCCCGCTGGGCGCTCATCTCGGTCGCGA
GAAGACATTTGCCGCTGTGTCACGCGACCTTTATTGGCCACACCTGTACAAATGGGTGCGTAAGTGGGTGCGCACCTGCGAGACCTGCCAGCGCATGAAA
CCTGCCTCGTCTTCGCAGGCTCCCTTGCGTCCTCTACCAGTGGCCACCGAGGCCTGGCGCTCGGTGTCGATGGACTTCATCTTCGGGCTCCCACCCGATG
CTAAAGATAGATCAGGTGTCTTGGCATTCGTAGACCGCTTCAGCAAGATGGTTCACCTGATTCCGGTGTCGGATGCGATCACCGCGGCAGATACCGCGGT
GCACTTCCTCGATGCTGTCTTCCGTCATCATGGCCTTCCCGAATCTATCGTCTCCGACCGCGACCCGCGCTTCACGTCGGCCTTCTGGTCAAAGCTCTTC
GAGCAACTGGGCTCGAAGCTAATGATGTCCACAGCAGCCCATCCGGAAACGGACGGGCCAGACGGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTTCGA
AGCTACGCGACGTCGTTCTCCAGCTGGAGCTCGTTTCTGCCACTGGCCGAGTTCGCTTTGAACAACGCGGTACACGCGTCGACTGGGCTGACGCCCTTCT
TCGTTAATAACGCGCGACACCCGCGTGTCCCTGCTCTCCTCGCCGTGG