Description :
From Genome Similarity Track
Location :
Scaffold_36:335190- 372022
Transcript NameFunction/comments
Phyin_T30-4PITG_14585Putative uncharacterized protein
Phyin_T30-4PITG_145865'-AMP-activated protein kinase subunit beta%2C putative
Phyin_T30-4PITG_14587Putative uncharacterized protein
Phyin_T30-4PITG_14588Putative uncharacterized protein
Phyin_T30-4PITG_14589Choline-phosphate cytidylyltransferase B
Phyin_T30-4PITG_14590Putative uncharacterized protein
Phyin_T30-4PITG_14591Choline-phosphate cytidylyltransferase B
Phyin_T30-4PITG_14592Putative uncharacterized protein
Phyin_T30-4PITG_14593Putative uncharacterized protein
Phyin_T30-4PITG_14594Ubiquitin carrier protein
Phyin_T30-4PITG_14595Putative uncharacterized protein
Phyin_T30-4PITG_14596Transcription initiation factor IIB%2C putative
Phyin_T30-4PITG_14597Putative uncharacterized protein
Phyin_T30-4PITG_14598Prolyl endopeptidase%2C putative
Phyin_T30-4PITG_14599Putative uncharacterized protein
Phyin_T30-4PITG_14600Putative uncharacterized protein
Phyin_T30-4PITG_14601Putative uncharacterized protein
Phyin_T30-4PITG_14602Putative uncharacterized protein
Phyin_T30-4PITG_14603Carbohydrate-binding protein%2C putative
Phyin_T30-4PITG_14604Putative uncharacterized protein
Phyin_T30-4PITG_14605Putative uncharacterized protein
Phyin_T30-4PITG_14606Putative uncharacterized protein

Sequence
36832 bases(100 bases per row)
GACGATTGGTATTCGGAAAGCCATGGCCAAGAAGAGCGGAGGTGCGTCGCCGTGGCGCGGCCACGACGGATCGCTGCGCAACGTTGCACTACAATTTACT
AAAGCGACATGTGATGGGGTTATTGACGCAGGTTCGAAGCCCAAAGGCAGCGTCGGCAAGAGTAACAAGCCCAAGAAGGGTGGCATGTTCAAGGCGCTCA
AGAAGCAGGAGAAGAGGTGCGCGTAGTAGCTAAATTGCTGTATCCACGTTAATGTCACTGTGTTTAATGCTGTGCTGCATGCTATCGACCTAGAACTGCC
GTGGTAGGAGTGGATAAGAACGATCCGCACAGCAAAAAGCGCAAGGCAAAGGTAGCCAAGCGTCCAGCAACTGTATCCGACGAGCTCCGCAGTTTTGACG
AGCGCATGGCCGCAAAAACTGCGCGGCGACCCGGAGCTGTGCCAAAAGTTGCTGCAGTGGCTCCTCCAACATTCGTGATGGCAGCTCCAACCTTCCAGCT
GTAAGTCGCGATGTGTTTTTTCAAGCTGTTGGACTAGCCCAATAGAATTCCAACACAACTTCTGACACTCTTGCAGCAATTTGAATCCTGTGCAGCCAAC
GCCAGCGCCACGTGAAGTAGAAGGCTTTCGTGGATTCATGTCGGCGTTGGAAGCCCCAAAGGATGCGCCAGTTGTGAACCCAAATCGTAATGCGCGTCAG
CCTAAGACTGTTCAGCCAAAATACCGTGGCAGCAATGTGTTTGCAATGCTGGAAGATGAAGATGAAGAGCAGCAGAAGACACAGATGGCTTCACAACCGG
CGCCGACGTTCATGCAGCCGGCAACGTTCACATTCGCAACAGCCAAGCCGACTCTTACGTTGCAATCTTCGTTGCAGTCCTCACTACGACAGAACATGCA
GCCAGTAGCAGTGACTGCAGTACTGCATACAGAGGACATCGATCCCGACTTATAAGGCGACAAAACACGGAGAGCTTGAAGCTATGACACTGTTGCAACA
AGAAAACATTTGATTACAGAGGTTTTGTTTAAGCTGGGTCCTTACCGCAACGTTCGCGCAACCATGTGGGCAGTTGCGCGATGATGCGTCGCCGTTGAGG
CTTGGGCTTCACGTGGATTTGTATGTGCCTCTTTGTACTAGAGAGAAGCTCAGCCGGAAGAGAAGCGTAGACCCAAGCAGCCTCCACCAGCAGCACTGCG
AGCAAGTGACGCCACCGTTTGCATTCCCTCCGTCTCCATTGCAAAGTAGACTGAACAGCGCAGTAAACTACGACCGGGAGCTCCGTCTTCTTGAGCAGGG
AGGGAGAGTACGTAGCAGCGACCAGATCAGTCGCATCGTCCTCAGGCATTATGGGCAGCGCCACCAGCAAAGCGGGCGACGCGAATCCCAAGAACTTAGG
AGCAGACCCGAACGACCCAAATGCGTTCCCGCTACATCACCATCCGTATTATAACCAGGCACAGCAGCAGCAAGGTCGCAATTTTGACGGAAGCAGTGAA
GGAAAACACTCGCAACAGCCCTATTATGCCGGCCAAAGCAATGCGACCGAGGCAATGGAAGTGGATCCGCCTACTGAGACCTCTTCGGAGGTATCCTATG
CAGACGGAGAGATGTCTACAGCGCAGATTGATGGTAAGGGCGCGGAGATCGGCAAGGGGGACAATGCACAGACTGTAGACGTCACGGTGCCGCCTGGGGA
GGACGTTGTGCCCATGGTGTTCAAATGGGAACACGGCGGACGCAACGTGTTCATCACGGGCACATTCAATGGGTGGGACAAGCAGTGCCCAATGCACCGA
TCTGGCAACGATTTCACGTACATCGCCAACCTCACGCGGGGGAAGCACATGTACAAGTTTGTGGTGGACGACGACTGGCGGTTCGCCCCCGACCAGCTCA
CAATGGCAGATGTAGAAGGCAACGTTAATAACTATGTGGACGTATCGGACTTTGCGCCGCTCTCCGACTTTGACGGGAAGAACAGGCAGGACGACGACGA
AGACCCCGAGAACCCGTACGCACGGTACATCCCCGAGATCGACGAGTACACGAAGGAGCCACCTCCGCTCCCACCTCATTTGCGGCACATAATTTTGAAC
AAGGTACGGAAGGCGCTGCAACTTTATTAGGAGGTTTGTGCTGGGTCCTGACTCGCGTGTTTTTGCGTCTGCAGGCGCCGCCGACAGTCGATGGGCGATT
GCTGCCTGTGCCTCAGCACGTGGCGCTCAACCATCTTTATTGCACTGCGATCAAAGATGGAATGATGGTGCTGGGCATCACTAACCGCTACAAGCAGAAG
TTCGTGACCACCGTTTATTATAGCCTCATGCCTGGCGCCAACTAGCTCTTGCAAGAACTGGTTAGGCTCAGCGTAGAAGGCAACGCAGGTAGAAAAATAA
ACGGGAAGAAGCTCTTGAGCGCCGTCGTGAATGATCCAAGTGTTGGACGCGACGCGGGCATGCAGTGCGCGTGCTATTTTGCTCGGCTTCTGAAGGAAGT
AGACACTCTTTTTTTTTTGGTAAGGAGCTGCTCGCGATGGTCGTAGCGGTGGCAGGGCATGGCCAACCTAGGAACGGCGAAGTCCTAAAGCAATGACAAG
CGAGCACAGTACATTCTCCGTCCTTCTGAGCCTTCGCCACACCCCAATCCTACGACCCATGAAATTACACAGCCAACACACGAGCGGTGCAAAAACAAAT
AAACATAATTGCTGTTTTCTTGTGTAGCAGTGCTCGCTGTCTCGACGTCAAATGACAGCTCACTGCACTAAATCGTGCCGAGTTTTTTGCGCTCTTTTCC
ACCAAAACTGCATGTCTCCGTCTGTGTCGTATCATCTCCGTCTTCTGTCGTTGGAACAAGCTTCAGTAGGACGCTTGGCACCAACTGCAGCGCTGCTGGA
TGGTTCTTACTTCTGTTTTATACGTAGATCTCGGCCCACAAGAAGAGGAAGAGCGAGCCAAAGCCCAGCAGCAAAGAGGCGATAAAGGCCAGTACCAGCT
CCACGACCGCATTTTTCTTGGGCGCCACCGCACGCGTGAAGAAGAGCGCCATGAAGACAAGTCCAGTCAACAAGAGTGCGGCTGTGAGGACGCCGTAGCT
CTCCGGGTTCACAGGGCTCGCGTACGGGAATTCCTGCAGGGAACAGATACAGGTCAGTAGGCGCAGACTAAAAGCCTCCACTCTAGGATCCACACAGGCG
CACCATTTCCATCGTGGCGAAGTATCGAGATCTGCTCGGAGCTCGACACGTATGAGCTTGTATACGTTATAGCAGGTAAAATAGGATTTCAAGATAAATT
CATTTTCAAGAAGAAGGAAGATCAAGTCTGGTTGATTGTCGTGTTTGCCCAGCATAAATACGAAACTACTACATGGCTTCGTCATCTTCACGCATCGCCT
GCTTGAGTCGCTGCACGAGTTTCGCCTTGAGCCCTTTGGTGCCGAGGCCGCGCTTCTTCAGCTCTGCTCGCAGCTCGGTCACCTTCATCTTGTCGACTTC
GAGGACCGCGTCCTCTTTCGGCGCCACAGTCGCTTCAGTCTCCACGTCATTGATTTCCAGCTTCGCACCATCGGCAGCCTCGTCATTCTGCTTCGGGCTC
TGTGGCTCCTCCTGTACCTGCTCTACCGTTTTCTCATCCCGACTGGGAGATGAAGCTTTCTGAGCCACATTAGAACCGTTCACCGTATTGCGTGGAGAAG
GGCCGCTTTCTTCTTTACAATCACTCTTCGTGTCAACAGCCGTGTCATTCGTCTCTCCACCATCACTCCTCCTTTCTCCATCCTCCATAGCAGAATCTTC
CGGTGAGCTGTCGGACATCTCCTCGCCACTTTGCTGTGCCTCCTTGTGGTCCTCCTCGGGCTCTCTACTGACATTTTCCATGCTCTCATCACCCTCCGCG
TCCTCCTTCTTCACTCGTTTCTCCGCAGCCTTCTCCTTGTCAGCCTTGTGAACATCGTCTAGCTCTTCACGCAGCTTCTCTAGCTTCGTTGCAAACTCCG
CTTCCAGCTTTCGCAGCTTCTCCTCGTGGGTCTGTACACTCGCCTTCATCTTGGCTTCATGAGCTTCCATGGACGCAGCAACCAACTCCTTCGTCTCCTT
CGTGTGTTTTGCTGGGAGATAATAGATCGGTGGAGACGCGATGGTAACCAGAAATTTCGACTGACTCGCGCTTTTCCGCAGCATCTGCAAGTGCTCCAAC
TTGGCGCGAGTAATCTGCTCACTGCGATCCAACTCAGTGCGAGCTATTGACGCCTCCAGTCGAGCTACCTCAGCTTCATAGCGTGCCTGGATTTCAAGAT
TCTGACTCTGCTTCTTCTCCCTCTGCTCGGCTTCATGCTGCTTCGTGTCCTGGCGCTTAAACAAGTCGGTATCCTTCTCAATCTGCCGCTTGGCCTTGCC
TAGATGTCCCATTAGCGCCCCAAACATGCGTCTGCTACGTGCGATACCGTCCTTCTGTGCATACGGCGCCACTGCACGTTGCTTCCGCTCCTGTGTACGT
GCGTTGTTCGTAGAGGGAGAAACAGCTGAGGTGGAACTCCTGCTCGTCTCCTCCGCTCTCTCGTCATGATGACCACCCTCCGGTCTGGCCACTGCAGAAT
GGAGCCTCTGTCTCTTTACAGCGCTGCTCTGCTGATTGTCCTCGCTGCCACGCTTCCCAAGTCTTCGCGAGGCATCGCCCCGACTGTTGTTTTCCTTAAG
CTGCACAGCGTGTCGGCCTGCACCTCCTGAACGTGCGGTCTCGTCACCAAGGCGCGCAAACACACTACGTCGACCTGCTACACCTTTTGATGTCCCACTT
CTACGACGTTCTGTAGATAGAAGGAAAACGCAGAAAAGTAATTAGATGAAAGATCGCATCGTAATATGTGGCGTCCGACAGCAACTACAGCGCCTAAAGC
CCATGTGAACGGGTAATACACGAACAACGCGACGTACTGGAGTTATCGAGTGCCTCTCGCTTTTTAGTAAGCTCCTGTAGCTCACGACGTAGCGCCCGCT
CGTCCGCCGATTCCGCCCGATCTGCCATCGCTCGGCGCTTTGGTGGTCGGCCTTGATTTTGGAGGGGGTAAGGAATTTAAGTTGTTATAGCAACATAAAA
TGACAATGTTGCGTTAAACTCGAAACTTACGGTGCTTAAACCTTGAAGAGACACTGTAGAGCTGCGATGGCATCGCCCAGTGCTACAGCTGACGACGCGG
TGGCTAAGGCGCTGGAGAGGCTACGGCAGAGGAAGGCAGAAAATTTACCTGTAGAATATAGGGATGCTCCAGCGGCGGTGACACCAATGTCAACCTCGAT
GCATGCGGCTCAACCTGCCGCCGGATTCCAGGTTATCTGCTCAGGTGAAGTGGAGAGAGTCCATGTACGTTACCGTTGTAAAATGCAACGAGTTTGCCGG
AGAATAACTATCTACCTGTTGCGGTTAATAGTACCCAGGCATCACAAACGTATACTGCCGCTATGCCATCACGTACGGCGTTGACTGGCGCGTGCTTCAT
GTGAGTCTTGGCATCTCTGTCACATTCGACAGATAATCCACTTACGGCGTTGTTGGGCTGCAGGGGGCTGAAAACGGACTCTCGCAGATTGCGTACTTGG
CCAGCAATGAAGACGAGATCTTGCTCAACTTTCCCATCGACGTGTCATTCAAGAGCACCAACCCGTTCGGCTGGCCTCGCCTGGTGCTGAGTCTGTACGG
ACTCGACGCACTGGGTCGCGACGTGGTGCGAGGCTACGGCTCTATCACGTTTCCTGTTACACCAGGCTGCTCGATACGGGAGGTGCCGCTGTTTCGGCCA
ATGTCTTCGTCACGAATGCAGCAGTTTATAGCGTGGCTAACGGGATCACCGCCCGAGTATTTCGACTCCAAGTTCGTAGCACAAAGCGATTGCCGTGAGG
TCACACGAGTCACCTCTGCAGGCAAAGTACGCGTCGTACTGAACGTGGCAACGCACGGGATGAAGCACCACGGATACACATAAGCAAGATCTGTATGTCT
TGTCATTTCTCAGTTAACTCTTTTGACTCAGTCGTTACACAACCCAAGACACAGCTAGCGAGACCTGCTTCACAGCAATGCACACTCGCCGTCTCAAGTA
TTTGCAAGAGGGGCGTGTGAGAGAACTCCCGCAGCTTCGTTTAGCACAATCCTTCGCGCGCCATCTCGGACATTCGCTCCGACAATCGCTCCTTGATGAT
CTTTCGGCGCTTGCGGAACGATGTGCGCTGTAATATGAAAGCAACAAGACAACACCGTCAACAAGGCCGACTACACACAAGGACAACGCATCGACTGGGG
CTTCAAACGTACCAGACGGCCTTCCTTGCTGAAAAGTTCCAGAAAGTTGTGCTGCATCTCATCGGCCTTGTTCATCCACTTGTGCACGAAACCATCGACG
TCGTTGCGCACCTTATCTACTGCCATGTCAAACTTGATACTTTTCTCCTTGATAAAAGGGACGTTCATGTCCTTGCCCGAGTACCCGCGTTGCAAGTTGC
GGCGGATGAACGTGTCGTACTCTGCGATGATACGGATAATGAGGTCGGATGTCGAGATACCGTCCGTACGTCGCGTCTCCAGGAATTTGCCCATCGCCTT
AATACGAGCGTACACGTCGCCCTCTGACGCCTCGCCCGATGTGTCCGAGTACGGTAGTGCGTCGTGGCACACATAGTCAATGTCGTGCTTCTCGAGAAAA
TCGTCGGACAGCACCCAAGGAGCGTCTTCCACCACTTCATCCACCCATCTACAGTGACGTAGAGACTCATAACGCTCCTTGTCCGTCATGACGGTCCGGC
CCTTGAGTTTGTGCGTAATCTCGTCACTGCAGCAGCCAACCAGCAAGTACGTGTTGGGGTACGCATTCTTGCACTGCTGCAGAGCCTTGGCATGTCCAAA
GTGGAAGAGATCGAAGATTCCATCGGCGTAGAGACGCAGGGGGCGACCAGTGAGGGTACCGGGTTCGCCTTCTTTCAGTTTCTTGCGGTAGGGCTCCGGC
TGCGGTTCGGCTGTGCTCTCCTGGCTGCTGACGCTGCTGTTGTCGTTGACCTCGTTTAAATCCTCAGCTGTCGGCTTCGTTTCCTCTGCGGCGGGTGAGT
GGTGGTTGTCCTCAGCCTCATCGGCATTGTTCATTTCGGCGGCACGTCTCTACATTTCAAACAATCTCATTAGCCCTTTACAATAAAAGATATCGGTGTT
TTTCCACGACGACGTTTGTGGATATCGAAACGAATGAGACTCTATCGTCGAAATCATTCGCTGCGACGCGAGGGATCGCTACGGGAAAGAACGCACCTTT
CTCGCCATCTTTGCGCTTCTGTCGCTGTTCGTCGAAAACTGCAAGTGACACGAAGCAAAAATTAAGAGCATGTACTCGTACTTATTGGGATTAAGTACGG
CTAGTACCGATTTCGGTCAGTTTAAGACCGATCTCAACTGCGACGCGTCAACATCACCCACTTCAACATGATGATAGGCTCCTTACTAGGCTATGACAAA
AAACGAGGGGATTATATTAAACTTAAAAATTGGCTTTGCTCAACAAAAGAGGTTTATGCTTGTTAGTAGGTTAGCTCAGCACCGGACAGTGTAGCAACGC
GAGTGCTACCCGAGTAAAGTTTGTGCGGTACGTTGGCGAGCTGGTTGCGCTCTGTAGCAACCGCAGGCTGCACCACGATCGGCACCTGCCACTGGAACGT
TTGCCTCTGCTGCGTCGGAGCGTCGTTGCTTTCCTTTTGCGGCGGTGCTCCAGCCGAAAACTCGAAGCGCAGCAGCCACTGGAAGCGCACCAGGTCCGTT
TTGATGGTCGGCAGCGCATCGTGCGGGATGCTGAAGCGAACATTCGTTTGCAGTGTATCCAGCGTGCGCTCATGGAACTTGCCGAATACCTTGGACTGTA
CGACGCGGTCGGGATCCAGCGCCATAGACGAGAGCGTCTCTTCTAGACACAGCGTGGCCGAGACTTCGTAGCAAGGGATGCTAGCGCGAGTAAAGTCAAA
AACGCCCAGAAGAACCTCGCCTGGTTGGTAGAACTGCTTTGTCAGCAGGAAGCGCACGAGATGGCTGCTGTCCTTGCCAATCGTGAAGATGCTCGTCTGT
GCGCGTTGCATCTGCTCCGTTTCCACTCGGCCATGCATGAGCGAAGGCCGCAACTCGAACGCAATCTCGCTGCCTGTACGGACACCAACAGGTGCCGGTG
CTAGCGACAAACTTCGTCCGACGCGAGTGGTTCCACCCACCACGTGTTGCTTGTTGTGTGCGGTCGTGGCGTTCTTGACCTCAGACGCAGCACTGCCATC
GTCCTTGTCCTGACTCGAAGCGAAGTGGCTTGCACTAGCTACGGTGCCAGCCTCGAAGAAATACTCCGAGCCGTACACTTCGAACGGCAGATGCACCGAC
ACAGGTTTGCTCCCAGTAGTTGCACATTGCGCCGTGATGGAGACCACGTAGAAGACCCTCGCGGACGACCCACGGAATGTGGGGCAGACGTTCTTCGGCA
GAGCAATTGCAAACTCTCGTGTGCAGCGCTCCGCAGTCTCCTCGCGCGCAGCCTCGGCTGCTGACACAAGGTCAATTGCTCCGTGACTCTTCGCAGCGGC
AGCTCCCAGCTCCGACTGAGTCGGTGCAATATTGATATCCGAGAGCAGCACCGACGGCGCCGAGCGGAAAATGCACGTTCCAGTGTCGCCCGAGAAGTTG
CGTACGTCGGGCAACGCTTCACCCATTGTGTCATCCTCGGAGGGTTTGCGCTCTAATTGCACGACTGGTAGTGTCAACAGGTTGTTGTCCACCGTGACGT
GGCCGTGCACTTGTGCCACCACGTGGGAGATCTCCGAGTGAGCATCAGGCTTCTGCTGATGGCTTACGAGCCGCACGACTCCCTTGACGACGCCTCCTGG
ACGAAAGTAGCGGCTCGCAAGTCGCGCCACCAGCACGCTGTCCTCCCCGGCCTGCGTGACGTGGTCCATCGTCATCGAAAAGGAGTGATGGTGAATTGTG
TAGAGCACACCAAAGTTGAAGTGGTCCATCGGAGCCGTCCTCTCCCACCCACCAACGGCAATGCGAAACCGAATGGGGTTGTCACTGATGAACCCCACAA
TCTGAGGTGCTGCCAAGCGGTGGTGATGGAGAGTCCTTCCATTAGTCATTCCAGCTTTCTCCCTGCAACGAACAAATCAAGAACCACACTCGGAACATGG
CTCCAGTAGGCAGACATTTGTCGATGTCTTCGGTACCTCTAAAATTATACTTCAGTAGCTAAATGTCCCTGCTTTGGTATCTTGTAGAACATGAACAACG
AACCCGATCAGGAGCTCAGTATCGACAAACCTGTGAGCATCGACGCATCTAGTGGCACAAGCACCGGCTCAACAAGCTCCGCGCCGTTCCGCAAGACTCT
CGTTGAAGGCGAGCCCGGCACCATCACTGGTCGCCCTCTACGTCTCTACGCCGATGGCGTCTTCGATCTCTTCCACTTTGGACATGCCAAGGCTCTGCAG
CAATGCAAAGAAGCGTACCCCAACACGTACTTGCTGGTTGGCTGCTGCAATGACGAGATCACACACGGACTAAAAGGCCGCACGGTCATGACGGACAAGG
AGCGCTATGAGTCGCTTCGTCACTGCAAGTGGGTGGACGAGGTCGTGGAGGACGCTCCGTGGGTGATCAACGACGCCTTCATTGAGAAGCACAAGATTGA
CTTCGTGTGTCATGACGCTTTGCCGTACTCGGACACCTCGGGTGATGCATCTGACGGAGATGTGTATGCGCGAATCAAGGCCATGGGCAAGTTCCTCGAG
ACGCGACGCACGGATGGCATCTCGACCTCCGACCTGATTATTCGAATTGTTGCGGAGTACGACACCTTCATCCGCCGCAACTTGCAGCGCGGCTACACTG
GTAAAGAGATGAATGTGTCCTTCTTAAAAGAGCAGGGAATACGACTTGACATGGCAATGGACAAGGTGAAGGAGCGTGTTGCCAATGTCTTCAGTCGAAA
GCCAGGGCGATTCGACCAGCGGCAATCTGTGTAAGCAAGTCCGCGTGTGGCAACAAAATAGAGCTTCCCCGTGTGTCCGAAATAAGCAATCAAACCATGA
AAACACGTTACCATTGACTCCATATCTTAATGAGGAATGCTGGTAACTCCGTGAACGGCTCGCTGAACCTTATGTGCTGATGCTGCTGCCACTAACAATG
CTTGTAGGCCTGTAATAAAGAAAGAAAGTCAGCAATACGAAATCCTTGCCAGCAACCAAAGCGTACCACTCGAGAATTGCTTTTGCGCCTGACGAAGATC
ACTAGGCGGTAACGAGCTGAACCACAGCAGTGTGTCCGTGTTCCTGGCTTTAGTATCTGTTGCTTCTTCCTGGCCGCTCTTGCCTGCTTTCCGATTACGT
AGCGAGTCGTCGCCACTCTTCCCCACTACTTTTACCTCAGACGCATCTTGCAGTCGCCAATTTCCCTCAGAATCCAGTACCACTACCCGAAACGCCTCAA
ATTCTTCGTGATACGAAATTTCCGACAGCGCGTGTTCTTGCAGTCGCAGTTTTGCCTTCGTCAGCATAAGAAAGCCCTGAACCGATAGATCAACGTCAAA
GCTCTTTAACTTACGTTGCTGCTGCAGCAAAGACGCACCTGCTTGAGCTTAGCATTTGCCACCTCGTGATCGTCGAGGTATTTCTCTAAATCCTCCAGGC
CCGCGACCAACAGCTTGTCCGTTCCGTCGGTCATCTTGTTCTGCGATTCTGTACTCAAGTTGGTAGTTTTGGCAATTTATACTACTGTAGTAGACACATC
CGGAAACCAGTTCCGGTACCCAGGGTAAATTTGCTGGGTACAATTTAACGCTTTTTTAGTTGTCAAGTGTAGTTAAAAAAAAAAAATTCTAACAGCATAG
TACGGCAAAAAGAGGTTAACTCTTTAAGTAGTGCTGCAAAATAAAATATAGATTTCAACACCATGGCGCGTAGGCAGATCTCGCAGGAGACGTTCGACGA
GTGCGTCGCCGAGAATGTGGAGGACTTTGACATGTCCTTAAAGGAGGCGGTGGCCGATGCCGTGCAGCAGTTTGAGTCGCAGGGTGTTGACTTGTCCAAT
ATTATTAAGAGCGGCGCGTCACTCGGGCAGGAGTCGCTTCCTGTGCGGCTGAAGCGACTAATCTCGGAGCTGCAGAAGCTCTTGAAGTTTGAAAGCGAGC
AGGCCCACATATTAAGCCTTGTTGCGGAGCTGCAGAGCGTTTGTGAGGACGTTCCAGAGGCTCGAGTGGTGGCAGGACGGAACGACGCCGTGGATACGCT
TCTGGCGCTGCAAGATTCCAACTCCGCCGCTGTAGCGGCCTCTTGCAGCAATTTACTGGTGTTGCTGTGCGCTGATAATGTCGACAATCAGGACTTTGTG
GGTGCTGCAGGCATGCAGCGACTTGTGAAACTGCTGAAGCGTCACGGGGAAGATACAGAGACCGTGGTGCGAGTTCTTGCGCTTGTGAAAGCAGCTTGTG
TCAAGCATGAGAGCAACAAAGCGCACTTTACAAAGTCAGACGGTGTTGAGGCGCTGTGCAGACATTTAGAGAGTGCCAAGGATAACGAAGTGCTGTCGAA
GCAACTGGCGCTGTGCTTGCGAGTACTGACTATCAATGACGATCCTCGCGCGACGTTCTCGCAGGCACAGGATACTATCAAGGCTCTCGTAGAGCGTGGT
GTGATCCCGTATAGCTTAGAGATCCTACGTCAAGCTGGACGCAGTGATGCAACACAGACATCAAGTGGTTCGTCGGATCTGTTCGTCAGCTGGCTTGCAG
TCCTCAAGCAACTTGCAGTGACGGAGGACAACTGCCAACAGATCGCCGATCTAGATGGGTTAACCGTCGTTCAGAACGTCATGCTGACGTACGAGCATAG
CGCTCCCGTAGCCAATCGCTGCATTACCGTTTTTAGGAACGTGGCGGCTGCGGATGAGTTAAAGCGTGCGATTCTGCAGTCTGGGGGCGTCGAACGGACG
TTGCTGGTCATGCAACGTCATGAATCCGATGCATCTATCCAACAAAATGCATGTGCAACGCTGGCTGCTATTGCGCTCCGCTCTCCTGAGAACAGTCGTG
TGCTAGTCGAGCTCGGGGCTATTCGGCAAATCGCGCGGGCCATGCAAGCTCACCGTCGTGACGTGGCTGTACTTCGCCAAGCGAGTCTGGCGGTGCGTAA
CATAGTGGCTCGCAGTGTGGAGCTGCGTTCACGCTTCCTGCACGACGAGCCAGAGATCGAGCCATTGCTCCGCGAGGCCCAACAGTATCGTGGTTGCGGG
GACGAAGCCTACGCAGCGCTGCGTGATCTGGGCTGCGATATTCAGTTGTCCTTCTTCGGCGCTGCTGCGGCCTCTGCTGCTGCGTCGGGGTCCGTCAAAG
CATCTACAATTAAGCCACACTTTAATCCGGTTCAAGCTCCATCAAATCAGTTGCTCGAGAGCGTAGAGGAAGCTGCTGAGGCGCCGTTCGCCCAGTAATG
TGTCCAACATGGCAACTTCGCAGTCAAAAAGAGTACTTCTCTTTAGGTTTCAATTTTTCGCTTGTCCTTTGTGGCCTAGTTCTCTGTCCTTCCTGATCTT
CTTTCCCTTGTTACTGCACTGCTTTGTTTTATCTTACTGCTCATCCTCTGACGTCGTCGCTCGTGGTCTGCACGCTGAGTCTACTGTAGTCGGTTTGGAG
CGGAGAAAAAGGAAGAGAGGCAACGCATTGACAAGAATGGCAGACATTCAACTCCTGCTGCCGACCCCCATCACAATGCGGCAGTGAAGAAAAGGCTGTG
CAGTGCCACACAACGCGGCGGCGCGTCCGACGAGCGAGCTTTTTTATGCGATCGCCTGCCAGCTCTGCTCGACGATCTCGCGCACGCGGCGGTTGTACTC
CCGTCGGTTCTCTTGGAAAAGACGCGCGGCCTCCGAGTTGGCCGGCGAGTTCGGGTTGGGATCGCAGAGCAGCGACTGGATGGACGTGAGGATGGCCGAG
ATGTCGTAGATCGGAGACCACTGGTTCTGCAGGATGTCCAAGCAGATCTGGCCGTCGTTGTAGACTGCAAGCAGTAGAAAACACAAGTTAGTTACAGCAG
CACACACGACATGGCATGAAGCAAAAATAAGACCGCGTACTGTTCGGGTGGAACATTTTCGTGATGAATTTGACAGTCGGCGCCTTGTTGGGATAGTCTT
CGCTAAACTCAAGCGTCAGATTGAAGGTGCCGCCTTCCCATGGCGTGTCGTCCGGTCTATCATGATAGCGTACGTGATGTTAGATAAATGAATGAAGTTA
AAGCTGCGAGGCGTGGTCTTACCCGAAGATTACGGCCTGCCAGAGCATGATGTTGTTGTCCATGGGGGCGCCCGATACGCCCGACGGCGGGTCGTTTTGA
AGCTTGCGGAAGTCGCGCATTAATCGTCGGCGTGCGGCTGTGGACATAGCTGATGTAGCGGCAAGGAGACGCGGAGAAAAAGAGCTGGAGACGCGAGTAG
GCGGTGGCTCAGCTCGGGTTTTTATTTGACGGAAGAACGTCGGACATTCGAGAAAAGAATCTCCCCTGGTAATGCGATGACCGTTTTGGTGAGGTTTTAC
CTTTGTAGGTCTCTCAAAATTGTTTTCTTGGGTCTTTCAAAACTGTTCAGCTGCCTTTCAAGCTCCGATCTTCGAGAGCGAGGAGTCGTGAACCATAGAA
TATGACATCCTATCTTTAGCTGACGAAAAGATTCTCTGTGCTGGTATCCGCTTGTTTGATTGGCATCGTGGAGCGCCTAGTAAAAGAGCACCGAGGCGAA
TGTCCACAGAGCGGCTCGTGCCCGGCGACGGCCACAACCTCGTGGTGCTGGCCAGGTTAGAGGCAACCGGCATGAAGACAGTGAGCGGCTATTCATCCTC
ATATGATGACGTGTTCCCGACAGCGCTGGACGGGATCAGTAGGTCGCAGAGATCTGATAGTGCTTGTCTAGGAACGCGGAGAGCTTACATTTGTGGTCTG
GACGTTGTTGACTGCAGTTTCACGGAGAGAGTTCAAGTTCTGCGTGGACGTGCTCAATCAGACAGTGGAAGACTACTTTCCATGCATCCCCTGCTACGGT
TGTGGATATCTGTGGTGCTTTACAACGTGCGGGTTGTCGCTTTGTTTTTCGGAACCCTGCACCAAACAGGTACGCTTGCAATTGGCATTATTGTATTGAC
GCTTTTTACTTAAGTACAATTTTGGATGTGCAGCTCTCGAACAACTTGGATCTGGTGCTTCGTCGGCTAAACAACCGAGAGGAGCTGCTGTATCGAGGCG
TCGTCTGGAGTCTCAAGAGATGCCAACGAACACACACTTCGTGGATAGAAATCGCTCAGCTAGTGTACGAGTGAAACAAAAAAACAGTTTTTGCTTGTCT
GCAACAAGCAGACAAGGTATAGCACACCAAAAACAAAGGTTATGGAACAGCACGCGGCGTGCGAAGTCAATCAATAAACACAACGTACTTAAGTATTGTA
CAACAAAGGCCGTCTTGCACCTCTGTCAGCCATGCAGCATTGCATAGTTCTTCTATTGTCTTTCCATGTCTATCTATACATGTACCTGACCTGGAAGAAA
AAAGCAACAACATAAACATCAGTCCGAAGCAGCAATAAAAAACCGAGAGCTACAGTAGTAGATAGAAGATCAAGTTCTTGATTGTCTTACCATGCAAATA
GGATGTGCGTGTCCCATTAAATATATACGAACCTGAGTGTCTTCTTTCTTTTTACTTACGAAGTCTTCTCCCATTGCTGTCACCACTCAGCGCCACCACC
ACGCCTCTCTTGGATGTCACAGTATCGTAGCAGTTGACTAAGTCATCACCACACCCTCGAAAAGCACAACGCGACTCTTGTTCAGCTCCTTGCACACTCT
CTTCATGCTCTTCTCGCCAATCATCGTAACGTCACTAATCTCCTGAATCGAGCGCTTTGCGTTCGTGTATGCTGCCACCAAGTAGATCACCGACGCTGCC
ACTGCAACTGGGGGTTGTCCATTAGACAGCTCCAAGCTGTCTGCCTTCTTCGCCACCGTGTGTGCTATCATCTGAGTCTTGTTTGGCAGTCCTAGTCTCG
AGCAGAAGCGCTGCACATACTCCTCCGTCGTCGCCTGTTTCACCTCGAGATCCAAGCGGCGCTGCAAGCTCATAAATGACTTGCCAATACGTCGCTTGGG
GATGCCGGAAGCCTCCTCGAATTCTTTCAATGATCGTGCATTGCCTGCCTTCCTACACGCGATAAACAGCACTGCGACGGCCATACTTTCTCGTTCCGGT
CCTCGCATGTTGACACCCTGCTTCTCCGCTTCAGCGTACACGTCCAGCGCGATCTCCACAATCTTCTTAGGTAGCGATAAATAATCTGCAACTTCTTGAA
TGCGTGCCATATTGCGCTGCATCCTCTTCACCTTGGCGCTGTCGGACGAGATGTTGGGGCGCTTGTGCTTGCGCCCAGCCTCACCGTCAGCGCCCCCGCC
GCCCTTCTTCGGGTCGACCAGATACGTGGACAGCGAGAGGCTGTCCAGCCGCGCGTCCGCGACGTCGCCGACCCTGGATTTCGCAGCGGGGTCACCACCC
CGATCATCATTAGCAAATGTTCGCCATTCGGGGGAATCATCTATTATGCGCTCACCGAGGATCATGCCGCAGTCGCGGCACACGACGTCGCCCGCGCTGA
AGTCCGTCACAACGTCCTTGCTTCCGCACTCGCGGCAATGATCCGGCACGCACTCGCCTCCCATTTTCAATGGCTGATGAGGACTGTTTCTTCAGGAGCT
TGCACTACACTCAACTTGTCCAAAGGAGAAGCTTCAGGGTTCTATCGAGAGAGAAGACGCTGGGGCAATCTGACAGTCTTCCTTGGTCGATGTCCTCCAG
GCTGCACTCCCGCGACGTCTATAATCTAAGTTGAGGTGTGCTCCTTTGGCCGTGCTGCGCCTTGTGAAACTACTGCGATCCACCAACTGGCCAACCGTGT
GCGTCACACAAAGGATGTTATTTAAAAGGTGTTGGTGTGGATACATCAAATCTATTCAATTTCGAAGGAAATACTACAGTAATTGCTCGGACACGAAGCA
GCATGTGCTTGTCTTGCGCGATCCCGCTGCGCTTAGTAGCGCGAGCTTGACCGTGTGTAGAGCCCACAGAAGCTGTCAACAACACCAAAAACGCTTGCAA
CCACGTGATCGGGCCGGTACTCGATTTGTACACCGCGCAAGGAGTCGTAGTTGCAGCTCTCGATTCTTCTCCCGGCTTCGTTGCTTAAACATTAAATGCA
GCAGCCTAGAATATGAATCCCTTCTTGGTCAAATCGGCCTTCGCCTCCACGACTTGCTGGTTCAGCTCCTTGGCCGCCTCGGGGCAGTCTTGTACAGCCA
TGACGGATAGTGCGATCACCGCCAGCGAGTATGCGCCATAGGACACAAGCACGTACATGGGCAGCGCCATGACCACCTCCTGTACACGCGAGTCTTGGAT
GTGGTCGGCTGCGTACCGTAGCAGCAGTAGCCATAGCGCGAACAGCACGACAAACGCAGCGAGCCACTTCTGGTACTTGAGCATCGCGGTCGCTTTTTTC
AAATGTCATCTTAAAAAGAGACTCTGTCGCATTCTTTTCGGAGCAACTGACTATTACTAAGTGGACAAAAATACATGTGGGGCCTTCTTATTTGCTGATA
ATATACTGTCCAAAATAGATGGTGGAAGATTGTTCACTCTGCAACTCACATGTCGGACGCGTCGGTACTCTTGACAGACACTGTCAGCTACACGCCTGAA
CTGCCGCAGGAGAACAAGACGCATGGACGGCGCAAGCCTAATCTGACGGATAACCAGCGCCTTGTGATGGCAGATTTTCTGATCAAGCACAGCCAGGGCG
AGGCTCGCCTACCACGCTCGGTCATCAGCGCTGCTGCTGACAAATTTGAGGTGCACCGGAACACGGTGTCACGAATTTGGAACTCCATGAAGGCGGCGAT
GGACGTTGGAGAGCCCACTGACGTCGTGATGAAGCAAGCATTGTCCAAGAAACGTGGCAACTGTGGACGCAAGAAAAAAGATCACTCGGCCGCGTTGGAG
CGGATTAAGCAGCTCCCGTTGAGCCAGCGTGGCTCGCTCCGAGCGCTTTCTTCAGCTGTGGGCGTTCCTCGCACGACGCTGTACCGTCTACTGCGAAACG
AAGACTCGGTTGGCAACCCAGTGAACAATACCGATGATCAACAGGACCCCAGCTCCGATGTCACGCCGACGATCGCCAACGCGATCAAAGCGTCGTTGTC
TGAAAAGAATAAACGTGAGCGACTGAAGTTCTGCCTGGACAAGATGCAGCCCAACGGGGTATTCGACGACATGTTCAATGTGGTGCACGTTAACACCAAA
TGGTGTTCCATGCCGGGGAATCGCGACGCGAAGAAGACGAAAGCGATGTTCCTCATTGCCGTCGCTCGGCCTCAGTGGGACAGTCAACGACAGCAGCAGT
TTGACGGCAAGCTTGGTGTCTGGCCCTTTGTGGTGGCAGACCCACCATTGGAACCCTGCGCTGGAGCCAACGCATTGCCTTGGATCCAGGCCGCATCACA
AGTCGGACGTGTGTTTCGCGTACTGGAGACGATCACCAAGAAGGAGATACAGGCGATGATTACGTCCTACGTTATTCCAGCGATTAAGACGAAGATGCCG
AGCTCGTTACGCAACGGACCAGTCTTCATCCAGCTGGACAACCAACAAATTCGATTAACGCCTGATGACCCGGTGGTGGCAGAGCACGGCAGAGTTGACG
GCTGGGATATTCAGGTGCAGTACCAGCCAGCCTACAGTCCAGAGCTCGTGGTGCTAAATCGCATTTTCTTCAGGAGCATTTACCCGGAAGTGGCAGCGCG
TATTGTCACCATGCAGGCCCCTATGGAGGAGCTTATTGCTGGCGTGGAACGCGCATTTGCTGCTGTCTCCAAACGACAGATCAACGATGCGTACCTGGCG
CTGCAGAAGACAATGGAGTGCATTATGCTAGCAGGCGGGGGGAATGATTTTGGCTCACAAGAAGACTCGACCAAGAAGAGTCTGCAGCGAGACGGCAGTT
TAGCGGTGAGCGTGTTGTGCAAGCGTGAAGCTTTGCTGGCTTGTCAAACCATTTTGAATGCTCCGCGTGAAGCTGCAACCTCGTCAAGTGATTAGTTAGA
TGTAAAGGCGTTTCCCTTGTCTCCAATAGTATAATTCTAACTGCACTTGATGAATCGAAGCGCTGGCATTGACGTAGCATGCAACGTTGAAGTTGAGAAA
TGTGGACCACCCAACGGGGGCATGAGTTTCCTCTTCTCAGCCAGTAAGAACAACGAAGCCTGCTTGCGTCCAGCCCGAACTGTCTCCTCCACCCACCGTC
AAAGTCTCCAGAAGATCAGCATGGCCGAGCTGCCTCTGAGTCCTGCCGTCGCCGCTGTGCCCACGCCAGAGGTTCTTCTACCTGTCCCAGAGACGGCTAT
AACACGCGCAAGCCGTGATATCAGCTCCTCTGACAAGAAAACAAGCGCGTGGAAGGAGCGTGGCAGCAGGAACTTAACGTATGATGAGCGCCGCGCCATG
CTCGACTTCCTTCTAAAGCGACGCATCGAAGGCTCCACGAAGCTGATGCGGCACGCGGTCACAGACGCAGCGACCGAGTTCGGTGTGGACCGTCGCACCG
TCTCAAGGCTCTGGAAGCGCGCAGTACAGAGCTTGGAGAACGGCGACGAGGTGTGTGACGTGGCGTCACGAAAAGTCGGACGCCGCGGGCGGCGAAAACG
CGACTGGTCGGCGGAATTGGAGCGTGTCAAGGAGATCCCATTGGCCCAGCGAGGTTCCATCCGCGCTCTAGCCACAGCCGTCGGAATCCCCAAGACGACG
TTGTATGAGCTACTGAAGGAGGACGGGAATCCCTCCATTAACGCGATCAAACCATCACTCACGGACAAGAATAAGATCGAGCGCTTACGATATTGTGCCG
ATAAAGTGCGACCCAATGGTCTATTTGACGACATGCACAACGTGGTGCATATCAATATGAAGTGGCTCTCGCTTCCAAGAGATAAAAAGACAAAGGTCAT
GTTTATGGCGGCTGTGGCACGTCCGCAGTGGGATCCACAGAGGAGCGAGTTCTTTGATGGCAAAATAGGCGTATGGCCGTTTGTACGAGAAGAGATTCGA
CCTTGTATTCCCATTGAGAACACAGGTAGATCGCAGCTAGAGAGAACGTTTGTGCCGCTGGAGACTGTGACGAAAGAGGACGTGCAGCGAATGATCACGG
AGATTATTGTCCCTACAATTCGACACAAAATGCCAGTACATCTGACCATCTTTATCCAGCAAGACAGCGCCAAGATTCGCTGCTCTGGTGATGCGACGTT
TGCTGAAGAAGGGCGCAAAGAAGGCTGGAATGTCCAGATGCAGAGCCTGCCGCCGTATTCCCCGGACTTCACTGTGATGGACAGCGCTCTCTTCCGAGTC
GTTCAGACAGCATTGAAAACGTCGCCGCCGCCTCTACTCAACGCGTCAGTGTCAGGACTCACGGAGCTCGTGTCGTGTGTGGAGCGAGCATTCTCAACCC
TGACAAGCGACCAGATTAATGACGCTTTCTTGTCGCTGCAGAAGGCAATGGAGTGCACGATGCGTGTTCAAGGCTCCAACACGTACGAGCTGGGACCTAC
AAGTAAAGAGCAGCTGCAGTTCCAGGGCAGTCTACCCGTGAGTATAATGTGCGACCCTGACGCACTGTTAATGTGTAGAACAGCACTGGACGAGACAGCC
GAGGAAGGTCTAGAGACTCTCTGAAATCGTCGACATTTTCACGTAAAAATGCTAGGAATTTGAAGCAAGTTAGCAGGCAATTGGATCATCGCATACACGT
TTCCTGTTCGTAGAAATCCCCATCAGGAAAGACCGGCGCTTTAGCAGCTTAGGCGACGAAGGGAGCGTCGAGGTTCCACGCGATGAAGGCAAACACCTCG
GACGTCTCCTCGATGATCTTGGTGGTGGGTTTCCCAGCTCCATGACCAGACTTGGTGTCAATACGAATAAGCAGAGGGTTCGTCTGCGTCTCCGAGTTCC
CCAGCTGACGCTGAAGTTCGGCTATAAGTTTGTACGAGTGCAGAGGCACCACACGATCGTCATGGTCGCCTGTGGTGAGCAGCACTGACGGGAATCCTCC
ACGTCCTGCCAGCTTCTGCATGATCGGACTGTCAGCTTGGGGCACGTTGTGCACTGGCGAGTAGCGACGGATGTAGTGGAAGTCGTCAGCCACGTCTGGA
TCGCCGTAATCGGTGCGCCAAGCGTGGCCAATAGTGAACTTGTGGAAGCGCAACATGTCCATGACGCCCACAGCGCCCACAACGCAGCGATAGAGATCAG
GGCGCTGGTTGCTGGTCGCTGCCACTAGCAGACCGCCGTTAGAGCCACCGTGGATCGCGATCTTCTCCGAGTTCGTGTAGCCTTCTTTGATCAGATACTC
AGCAGCGCCGTGGAAATCGTCGAACACGTTCTGCTTCTTGTGGAGCATCCCGTCCTGGTGCCATTGCTCTCCGTACTCGCCACCGCCACGAAGGTTAGGC
AGGGCCAACATTCCATTGAAGTGCTGCACGAACACAAGTCTCGAGACACTAAAAGCCGGAGTGAGCGAGATGTTGAAGCCTCCGTAGCCGTACAAATACA
CGGGCAACTCGCCGTTCTTCGGTGCATTCTTGCGCTTCACAAGGAACATGGGGATCTTGGTGCCGTCCTTGGACGGATAGAACACTTGCTCGGCTTCAAA
TTGACTCGGATCGAAGTCTTTCACCTTGGTCTCACGGAAGAGCTCAGCTTCAGGCACTGTTCCAGACGTTGCAGCCTTCTTGGACAGGTCAATACGGAAG
ATGGAGCCCGGATACAGGAACGAGATGAAGTGGTAGAACAGCTCCGACTCGGTACGTTTGCTGGCCACCCCCACAGTGCCGACACTAGGCAGCGAAATCT
CGTACTGGAACACACCGTCAAGGTTATACACATGCAGCTCATTGTGCACGTCCTTGACGAGCTGCACGACCAGAAGGTTCGGCGCTACAGGGTGCACACC
CTCGATCACGATGGCGTCCGGCTGTTCTGGGATCACTTCTTCCCACACAGGCTCAGCACTGAGCTTGGTACGCACCACACGCTCGCGTGGGGCATTGGCA
TTGGTCTTAAAGTAGTAGTAGTCACCGTCATTCAGGATATACGAGTACGCAGCGTCCATGTTGTCCACAAGTTTCGTCACTGAGATCGTTGCGTCACTTG
GCCCCTTCAGGAAGCTCTCAAAATCACTCAAATCCGCGACGTGGATCATGTTGGCGTTCTTGCAGCCATCCTGGACGTAGAGCAGCAGCTTCTTGCCGTC
GTCCGAGACCTCAGCGCCGACGTTAAACGTCGGTTCAGTCGGATACGCGTACACCAGTTTGTCCTCAGATTGTGGCGTGTGCAGCTTGTGGTACCAGAGT
TGGTGGTTCATGTTGGAGTCCGTCTCGGTGCCTCTCTTGGGTCCCTCTGCATCGTCGTGCTTGTCGTCCTTCATTTTGTCAGGAGGAGGGTACCGTGAGT
AGAAGAATCCCTTGTCATCGTGTGTCCAGGAGATGCTGGAGAACTTGACCCACTCCACTGTGTCGTCCAATATCTTGTTGTTGTCGTGCACCGCCATGAC
TTTGATAGTCTGCCAATCCGAGCCTCCACGTGAGATTCCGTGCGCAAAGAAGAGCTTGCCGTCTCCAAGTTTGGCCTCCGAGAAGGCGCGACTAGAGAGC
GCAGCTGTGCCGTCCTCAGCTAGAAGATTGGGGTCTAACAGCACGCGCGGCTCGCAATGAAGCTCATCCTGGATGTACAACACGCTCTGGTTCTGCAGTC
CGTCGTTCTTAGTAAAAACGTACTTGCCTCCGTGCTTACGTGGAGCCGAGAATTTCTCATAATTGAACAGCTCCGTCATGCGCGCCTTTGTCTCCGCTAC
GAACGGCATTTGGTTCAATACACGCTGCGTCACTTCATTCTGCTTGGTGACGAATTCACGCGTCTCAGGCGAGTCCGGGTCCTCAAGCCAACGGTACGGA
TCCGCCACCTGCACGCCATGTAGCGCCTCCACCAGGTCTCCACGGCGCACAGTCGGGTACGTCAATTTCTCGGCCAGTAAACCCGCAGTCTTCATGGCCT
TCTTCATAAGGTCTTACAGAGGGGAGCAAATTGAAGATGTATGTCACTGTCTATCCTCGACTTAGTGGCATAGTAGGACGATTCGTCATTACTTGGCATT
TGTAAGTTCTACAATTACCAAGTCAGTTACGGCAAGTATACATGTATACATGCTGGATTCGCTAATGTGGAACCAGGTGCTGCGGCGCGTCGTGCACGCC
GAGGAGCAGCAGCAGGCCGAGCGTCGTCGACAGCAACTAGCACAAGCTTGTTCCGCAGACCCTGCCTCTTCGAATGCGACCTTAGCGAGATCCGACGTCT
CCGCAGAAGCCTCGCAATCGGCATCAGAAGGCGAGAACCCCGTCGCGGTAGCCCCCACCACTGCTAATGCAGCTACAGAGCCTAGTGATAACGCGACACA
CGTGGAAGAGGCAGAGGAAGATGACGACTATCTACAGAAACACTTATTATCACGTCCAACGTCGACTTGGAGCTGTCTGGAAGACACGCAACAGGCCAAT
TGCCTGTCTCTCAACGCTCCGCACACACTCGTGGCGGTGGGCGAGCGCGACGGTCGCGTGACGATCTGGGACAATACGAGTATCCGCGTGATCACACGCG
AGCTGGACCCGACTCTTATTGCTGTGGAGTCTCCTACAGGCGAGACGGTCAATGGACAGGATGATTCCACTTCCAAAGCCGACGGGGCAAAGAAGACAGA
TGCAGACGGATCAGTGGAGAACGACGACGCGTCAGTAGAAGATGAAGACGACGAGAGAACCGAAGACGCGTCAGTGGAAGAAGCCACGGAAGAAGACGAA
GCAGACGAGGATAACAACGAGAGTGAAGAGACCAAGACGGAGGACGAAGCGGACGCCTCAGCAGGTGGAACTGTGGTGACTCTATCCGATCTCCGTGTAG
TCAAGACAGCTCTCAAAGTGGTTTCTCAATGCGTGTGGTCGTGTGATTCTCATTGGCTGTTTGCTGGTTGCGAGGAGAAGTCGACACGTCGGGCGAGACT
TTGTGTGTGGAACGTCGAGGCCGCGACACTCGTGTCGGCGTTCAGATTCGACGGGACGATCACGGCCTTGAGTGCGCATCCATACGACCCAAAGTTGGTA
CTTGTGAGCTTCTGGAACTCTCGTCCAGTGCTACTGAACGTGGTGACTGGAGATAGAGCACAACTCGAGAATGTCCCGCTGGAAAACGCGGAAGTTGCCC
AACCAACGCCTCAGAATAATTCTCGCCATCCTCTGCTTGCATCTTGTGCGAGATATGGGCGTTCTGGGACGCGTATCTACTGCGCCACGTCGAAATCAAC
ACTGGCGATACTGGACGCGACGACTTTGCAGTGTCTGGACAGCTTGAAGCTCAACGTGATCATCCAATTTGTCGATTTGAGCGTCAACTTACGTGAAAAC
GCGATGTTACTCACGAGCTCCAAGGGCATCCACGAGTTCGTCATGGATTCCACGACTGCGACCGAGGAGCATCCGCTAGGACTACGAGAGGTGGCGTTAC
ACTCGACGGGTGCAGTACGCGCACCTTGGGCAGTTTGTTGCTTCAGTGGCGGCGAGGAGTTCGTGGTTGGGACTCCAGTTGTGCGTCATCGTCACGTCGG
AGAGAACGGTTTGTTCACGTGGCATCGCGCCTCGGTTTTAAACAAGACAACAGCTCAGCACAACGTCGGAGTGAAGGACGGAGTGCTCGCATTAGCGTGG
GATCACTCGAGACAGAGCGTGTTAGCGGTCTCGACCAGTGGAGCGCTGCATGTGCTCGAGGAACAATTCACTACTTCGTGGCCAGGAGCGATGTATCCTG
CGGGGTTTCGACTCATCACGGACAACGAATTACATCTCAACGTGTTCGATCGAGACGCGCAAGAGCGGAAACAAGAGAAGGAGAAACTCACGGAAGCCGC
GAAGAGTGCTCCGGTGGATGTGTTTTCTGTTCAAGGTCCGTCAGAGGAGTTCCCTGCGGAAGATGATACCGCTGAAGCTTCACTTCTTGACACTAAATTT
GAGAAGCCGTGCTTTATCCCAGCCATTCCGATCGCTTATTACCACCGACGACACGTCCATCAAGTTCACGGATTGCCATACAACGAGGACAAGCACTTTG
GTCTGGGTCAAAGCGTGTTTGAGCCACTTAAAGGGGCGTTGGGTAAGCAGAAGAAGAGCAGTTCGAGGAAGTCCAAGAGCAGCAAGAAGCGACGGCGCAG
ATAGACAGACACCACTCCACTTGTTGGCAGATAATGTGAAGAGCCTTTATCTCTTTTATTGTTGTTTCTACTGCAGCGCTGCTTCGAGTCGTTGAAATGA
TTGTGTCAGTGCACAACTTCGCATGACTTCGGCTTTCCTGCTCTTGAAGGAAGCAGATCTGGCGTCTGTGTACTGCTCGTCCTGGTTGTCTGTGTCGTGG
TCTGCAGACTCGTTGATTTCAAGACGTTCAACCATGGAGACTCGAGAGATCTGCAGCGCTCGAAGAGCTATCGAGTTGACCTGCAACCTTCGATGCGGCG
GAATTCTGGGAGAACTAGTTGGACTGACTGGGCTGATAATTGATGGACATTGGTCGGGTTCCGAACGTCCCGAGCTTTGCGGACTTTCGTGTTGCCTCAC
CGCTCGACTCCCTTCTCGTGATTTTCTTCCTCTTTTTTCCACTTCAGGAACTGCATCGCTAACGGAGATATCAAGAGAAACACAGGACGATGAAGTGGAG
ACGTGTCCGGCCCAGCCACATCGAGAACACGTCAGCTTACTGCGTCGCTGAGCTGCCACCGTGAGTCGTACAACGTGTTCGGAGTCTTCAGCTGTGAACT
TCTTGCGTTGAGCTAATGCCGTGGCTCTGCGCAGCTCGAACCAGGCTCTTCGGTGTGTTGTCCACTCCTGAAACAGCTTCAAGGACGAGGATTCTTGTGC
CAAGACCATGAGCAACACGGTCGAGGGCAAACTATACGCTCGTGCACCGTGTACTGACGTCACAGCGCAGTACCGTTCAAACGACATTGCCAGTCGCAAG
GTCTCCGCTATTCCGACAGAATCATGAGTCTGTAGCAGTTCTAGTTCCAGATCTGGCTCTTGCTTGCTTCCTTGGCGAGGAGATCCTAGAGTGAGTTGTC
CGGAGATCACGAGGAACACGCGTACTGGTTGGCCAGGAGTGAAGAGATATTCCTGTTGCTCGATGGTAACTGGGTGTAAATGAGCCGCTAGAAAGCGTCG
AGAGGAGTCTGCCATCGATCGAAAGAGGAACGTGTTGCGTAGAAACCTTTCTGCTTCTGGTGCGAAAGAGATAGCGGACGGTGGTAGCCGTGTGATGCCG
ACTTGGTGTCGACGCTGGAGCTGCTGAACGACGCAGTACGGCAAGCACAGAACGTGTGTGAGCGCATTTTCTCGAAGACCCAGGAGATTCCGCTGTCGGG
CACTTCCTGCTGTGGCGGTTGAGAGATGGTATTCGCAGCCGAACACTGCAGCATCGAGGCCGAAACAATCACCCGCGGTAAGCTCTCGTACTGGTAGAGC
AGGATGATGTACCACTCCTGTGGACATCCTCGGTAAAGTTGATGGAGTAGACGGTATCTTGTCATCCGGTACAAGGACTGGTCGGAACGAGAGCTCGCAT
TGTCCGTTAAGAAGGAAATATACGCTCTCGGTACGTGTCGTACTCTGCGCTGCGATCGTCTCGCCTGGCGTCGCTGAGAGCACAGTCGCGTGTCGTAGTA
TACGTCTCCAGGCTTCTTCACTCACGATTGAATCTTGCTCGTCTTCAGTGTAGTTGGTCTCGTCGTTCTCGTCTATTCTGTCGCTACACTGACCGGTAGT
TGAGGTCGCTGTTTCTGCATCGATCATACCCAGCGATCGAAACGTGCGCACAAGTTGGTGGAAATGCTGCGACACCCACTGATAAAACTCCGTCACAGCT
CTAGGACTCTCGCGTCGTATTCTACTATTCTCTGGGTTCTGCAGCAGCAACTTGAAGCTTTCGGAGTGGATGAATGGGTCGAAAGCAGCAGACTCAAGCA
CATTTCGACCTCGATGAGGCGGATTTCCTCGAATGATCGAGCCACGTACTCCACGAGGGGGCTCTGCATCGAACGCCTTTCGCTCTGCACGGACAAGTGA
AGAAGGTAAGGAGGATGCCCGAGGCCTGGGGAGGAGAACAGGCGCCAGCTCGTGTGTCTTCAAGCGGTAGCTGCCCGAAGCCGTTGACGGCGTGGCAGCT
CGAACATCGTCCGACATTCCGACCACGAGTTTGGAGCAAAGTCAAGAAAATGTAGACACTTTGGTCGAAACTATTTTATTTATACGTAAAATAAAACGAT
AAGGGTGGGCGAATTTCATATTTATTCTTGAGTGGCTGCGATGGAAATCCTAGGCCAGGCGACACTGCTATGTAAGAGTATCTCTCATCCTGCTAGTTGA
CGAAACTCAGGAGTAAGGAGTGGTTATTTCTTGCCTCCCTTCTTGCCACCCTTCTTGCCGCCCTTCTCCTCCTTGGGAGCTACACAACCGCAGCAATTCA
AACCAGTAAGGGACTTAACTCATTCGTTGCATTGCCACATCGAAGCGATGAACTCACCGTCCTTAGCGGCGGTCTTCTCCTCCTTGTTGTCCTTTCCCTT
GCCCTTGCCCATGATGTTCGAAGAGTTTGGCGCTTGAGAAACTTGGAAGCTTGAGCTGTAAGCCGAAAATCGGGGAATGACAACTTGTTGCAGGCCAACA
TCTGAGAGGGCACATAAGAAGGGGCGTCCGTTTTCAGTAACGGTCGAAATTACTTGAGCTTTGTAAGCTGCCTCGATCTTGAAGAGTCGCATGTTGAAGC
TAGCTAATTCGGTGACCCAATGGTTTCAGGGAATGTGGCGCTAGCCATCTCGCACGAGCAAAAATGGCAGCTTCGCGAATAAAATCATTGGCGTATATTG
CTTCATACTACGCCGCGAGTGCGAGGTTCTCGAGTGCGTCTGCGAGACCTTGGACGGCCTGCTGGCTGGTGGCGTCCAGTCGAAGACCGGCGGATCGCTT
GGCTATTCCCTGCAGGAACTCGGCGACGTACACGCGCGTGCTGTCGAAGTAGCGGCAGATCCACGTGGTCATCTGCATTTGACTGGTGGACATGTCCCTG
GGTTTGGTCTGCTTGAGCGTCTGCGCTTTCTCGTGGCTATACGTCATGCACTTACGCACCAACGCGACGCCAGATCGAGGCCTTTTGCGGCGTCTGCCAC
TTCGACCGGCATCTTCCTCTGCTGGAAAAGAATCGACGAGTCGAGACTCGTCGTACTCAAGTACAGGAGCCACTAGGTTGACAAAGTCCAGCATGAGTTC
AATCTGCGCTGCCATGACTCGCTCAGTGTCTCCCGAACTGTCATTTCCCTCATTTACCTCACCCAGTGCCTCAATTTCCCTCGCCACTTCCTCAACACTC
GAGCTGAAGCGCATCTGCACCTCATTAGAGAAAACGTCATCACCTCCATACAGTGCATCGTTCGAGTCCACGCCATCCAGACGACCAGGAAGAGATTTCT
GTCCCCACAGAGCGTACAGCTGCACCAGCATCAGCAATACACGCACGTGAGCAACGCCCGCTTCAAGGCGATACGATAAAGCAGAGCTCGAGGTCCATGT
CATTCGCTCAAGTACAGCTTTACGCAGGGCGGATACAAAGTAGAAGGCGTCTTCGTCGTTCAGCGACGGAGCGTAGACAAGCATGCTCATCAACTGAGCG
ATAATCTGCACGATCTGGTCGACAGAACTGCTCGTTCTGTTGACCCCCACGGCCCCAAACAGTCCCATCTGACTGGCAGAATGAAGCGCTGAGTCTTCAG
TGGCAGTTCCAACAGCATTTGGGTCCAAATCTGCCAGCAACACGATCGCAGCTTTCACTAGCGCGTCCATCTGAGGGATACAATTGGCCACAAGCGCCAC
ATTCGCCGCTGAGACCAGAAGTCGAAGCTTCTCCAGCGAAGCCTCGATCGACGGGATCGTGATGTGAGCGAACGCCAAGCACGATTGGATGAAATTCAGT
CGGGTGTGAACACGCTTCTTGGCGCCATCTACAGATGCTCCACCACCAATGCGCTTATGGACGTGCATGGCAAGTCGAAGAGCCATCGAGGATAGCAGCA
TCTTGATCGGTTCTAACTTGTAGAAAGCACGACGACAGTCTGTGTACAGCATGAGCAATGCTTCTTGTTGCTCGTCTTGTGCCCGTTCACTCGCAGCCTC
ATTGACGTATCCAAGTCGCGTAATAAATGCCGAGATATCTCGGTTGGCTTCAGCACGTTCAGACGCAGTACTGAGAGAGTCGAGAGCGTCATGGACACGA
CAACAGACAACCAAGAGTGTGTGTGCCACAGCAGCTTCTGGGCCAACGACATGGAGCCGTAAAGTGCCGGATCGCCGACAGGATTTTTTCATACTGCCGC
CAACAAACGCTCGCAACACTTTCTTGGCCACATTCACACTCGACTCCCGCTTAAACATACCCATTAGAGCCTACATGGAGTTGAATCCCCAGTCATCCGT
TAATGATAGACGATACACTACATGTAGAGTTTCCTAGACTCTTACCAGGAAAGATGTCGACGGAATGAGCTTGGAGAAGAACTCGTAATGCTGTTGGGCA
CCGAAGACCACGTTCTCGATCAGCGCACCGAGTAGATTGTACGTCTTGGCTGTGAGTTCTTCGGGTGTTGCTGCGTTCAGGTGGCGAACGACATCTTTCA
GTAAGATCAGCGCCTCTCGATGCTGAAGTCACACAACCAGAGATGCTCTGAGTCAGCAATATATTCCTCATTGCAGTGACTTTTCCTCGCAACGTACCGA
GAAGTGAGCGACGATGAGCTTCATGTAGGCTGCTGCGCACTCCATGTACTGCGTGATATCTTCTTGCGACGTGATGGCTGACCACGAATCGTTCAGAAAT
TGCAGTTTTCCACCTGCTTCGTTCTCTGCAATAGCTGGTACACTGCTGAGCTGCACAGCCACGAGGCTGTAGAGATGGCACTGGGAGATGAGCGACGGAG
ACGCTGTGCGGATCAACTCCAGCATTTCGGAGGGAGTTGACACGTAGAATGTGGCTCCAAAACACTCGCACAAGTGCTTGAGCACCATGGAGCTATAGGA
ATACTCTTGATAATGCGCCAATAGCGTGTCAAACGAGTCTTGAGAGGCCCCTGGAGCTGCGCATTTCACGAGCCACTCGACGGCAGGAGAATGCAGCGCC
AGATACTCATCGTACTCCATTTTGTGCGTTAGCAGCCAGTGCTCGAGCTTCTTTTGACGGAACCAGTTGAAGGCGTAGAAGTAGTCGAATAAACTGCTGT
TCACCACGATGGTCTGCTCTGCTGGGGACGTTGTGCCCAGCAGCTCCGAGCTGGTTAACGCCAGATACAGACGCGCATATAACGCGACCATGGGCTCTCC
AACGCCTCTGTAAACGCGCACACAAGTCGAGTTAGAAGCAGGTCTTCTGATTCAATATTCTGGCTAAAATGGCAATACTTGATCATATTTGACAGCCGTG
CTACAATCTGCGGGTACTCGCCATCACACAGAAAGCGGTAGCAGCCGAGCAACGCAATTTCGATATAACTGGGCAGATAACAGACACCCTCGTTGAGCAA
CCAACACTTGCTCTTCCATGCAATAGCGTTTCGACACGTACATTCGTGGTAGCAGCTCTCGGATACACGCAGTCTTGTAAAACCAGTTGCGACATGTTTC
AGTGGCTTGGATGTTGATTTCAGAGCTCATGAAATGGTCACTTAAAGGCTCTGGAAGAGGCTGCCCGTTGTCGCCCTCGGACGCTCGTGCGTGTATGCGG
TCGAACACGAGTTTTCCGAAAGCGTCAAGCACTTCACTCACCAGTACAAACACGCATGGGTACAATTGAGGAGCTGTATCGGCGTCTGCGAGCAGCTTGA
CGCACTTGATAGCAATCCTGAGCGCCTCCACTTTGTGATTGTGCTCCCAACTCGCAATCAGTCTCTTTTGCATCTCCTTGACCTTAGCCACATATTGACT
CTGGGAGATTTCAATGGTCTTTTCGTCTTGTTCGGGTGAAGGATCGTTCCTGTCGGGGTCTCGTTCCAGCTGCTCCAACCGAGCGCGAGTTTTCTTGATA
ACTGACGCCTCTGCCGGGTCGTCGGCCTTCTGATAGTCACTCTTGGGAGCGAACGAGATCTCGTTCTCGATGTCATTCACTTCGAGCATGCTCGCTTTGA
TTTTGAACGTGTGGTCCGCATATTTGGCCAATAAACGATCGGTGTGCTCCTTCCACTTGTACTTAACCGTGTTGGTCATTGCAGCAGCTGTGGCAGGTAC
TTCAGTGTCATGTACAGCGTCAACATTTGCTCTTCGTTTTAAGTATAAAGGCTCGGCTTCTATAATTTTCAGGCTTTTGGACGATCTTAGCACTCCCAAC
GGGTCCAAATCTCCATCTTGCAGCACCACAAGCTCCGGAGTCTCTCCACCACCGCTTCTTCGCTTAGAAAAAGAGTCACCCAGAGCTGACGCTAAGGAAC
TAGGAGGAGGATCCACTGCAACTGCCATAATCTTTAAATCCACCAAATCGGCTTGCTCCAGAGTGGTAAAAGACGCCAGAGGATGCGTCTCTTTGGCCAG
CAGGCCGCGCAGTTCCAGATCGTGACGTGAGCGCAGCGTCTGGCGGCTCCCCAAGCGCCATTTGATGGTTGGAGCCGCTACCAGGAGCTCTCGCTCCGTC
GCCATCATCGTCATCTGGAGCGCTCTTCGCTGTTTGAAGCTGGTTGGATCCGCTCGTACTTATTCGAAGATAATGTCATCGTATGATTGGCTACAGCTCT
CCTTCCTTTTCAACCAATGGTAGTATCGCTTCTGAATTCAAGCCCGCGCCAAGCATCTGAAGGTGGAGCAGAAGGGCGAGTCCGATAGCGCCCTAGTGAC
GTCTTGAATCCGCCCCCTGCGTCGAAGACAGGTAATAATCGAGATCTCGTTAGTCTTATCATGTAGTATATACAAAGGCGCGCTCAACGGGGCATTTAAA
TCATCTCTAGTATTCGAAACTGACTCATGTGCTGCTTTGTTGGATCGCTGCCTTGCAGGGACAAATTTATATAGATACAAGCTCGAAGATGTTCGGAGCT
ACTGCACGAGCGACGCAACCCGCGGCTGGCGGCTTTAACTTCAGTGGAGGCGCAACAGCTGCACCCGCAGCCTCGGGAGGATTCAGCTTTGGTGCGACTC
AGACAGCTCCTCCGGCGGCACCAGCGACGGGAGGATTCAATTTCGGAGGTGCAGCAGCGTCTGCAGCTCCTTCTGCTGGCTCATCGGGCTTCAACTTCAG
TTCCACTCCAGCGACAAGCACAGCGGCTCCGGTAGCTTCCAGTGGCTTCTCCTTTGGCGCTACACCCGCACCGGCACCTGCTGCCAGTACTGGATTTAAC
TTCGGGACCACGAGTGCAGCTCCGGCTGCTAGCGGTGGCTTTAACTTTGGTGCAACTCCTGCTGCTTCTAGCGGATTCGGCTTTGGTGGCACGAGTGCGG
CGGCTCCAGCAGCCAGCACAGGCTTCAGCTTTGGAGGTTCAGCGCCTGCCGCCAACACGACGTCGTCTTTTGGATTTGGTGGCTCTGCAGCTGCGAAGCC
CTCTCTTTTTGGTCAGATCCCTGCAACTAGCACAACGGCGACAGGATTCGGCTTTGGAGCCAAGCCAGCGACTTCAGGCACTGGCTTTGGATTCGGAAGC
GGAACTGCCACAGGAACAGGCGCTTTCGGAACAACTGGAGCGACAGGATCGGTCTTTGGCACTACTCCTGGAGCTCCGTCCACGTTTGGTGCAGCCCCCG
CTGCCTCGACTGCTCCAGCCCCAATCATCCTTGGCGCTGACGCTTCAGTTGCTCAGCTTAACACCGTCAAAGCAGCGTATCAGGACCCAGCACAGTCGCG
GTTCAAGTTCCTCATGTACAACACAGTGGACCCGACGCAGCGACACCTGTACACTCGACCAGCACACATTAGTGAGCGTCTGTGGAACCAGGCCGAGCTG
GACAACCCAGACCCGCTGAACTGCGCTCCTGTACCCATTTTAGGCTTTGACAGCCTGTTGAAACGAATCAAGGCACAGCAGGAACATGCTGACAAGTACA
ACACGTACACGGAGGACCTACGAGAGCAACTTAAGGAGATGGACAAGCACACACGAGCTACAGAGGAAAAGCTGGAGAAATGTCGCCACGAACACGTGCA
GCTGTTCCACGCACTTGTGCAGGTCATGAGGGATATCGAGTTGCTGCAGAATTACGGCAAACCGCTGCAGCGTGAAGAGATGCAGCTAGCGTACGTCTGT
TGTCTGTCGAGGAGCCATGCTGAGCACGTCTTGATACTAACGTTGGGATGCTGTTGTTGTGCACAGGATGATGTTGAAGAAGCTGCAGACATTGCTGGAC
TCGCCTGGCCAGTACAAGGCACGACTAAACGACGCTGTGTCACTGCAACGCGTCCAGAAGGAGACGCAGCCTCCCCCGTCCAGCCAGCTCAGTCCGCAGG
ACTTGCAGCGACTTTATGAGGTGGGTACAGAGAAACACTTTTGCCTTAGGATGAGTAGGCTGACAAGTCATGGCGTTTTGTGCAGTTCATGGACAAGCAA
CGACAGGGGCTGGAACACCTGACGAACATGATTAACGACGACCTGGCGGATATTCAACTCATCAAAGAAACGTGGCGACGGTAGGCGGACAGCCGTGCAG
CAGTGGCAATTGCTAGAAGAAAGCGCAGGAGGCAGCAGCTGATGCAAAAAGTTACCAAATTGTGTGTCTTTGTTTTTCTGAAATTGGAGCTGACTGCACT
GCTGCGCTCGATATTCTTCACCCTTGATACTTAATTCATGCCAAACAAAGTCGCAGCTACAGTAGACGACGTCCTTGAGATATTGATCTAGTGGCCGTAC
GGGTCAACGTCGCCGTATGTCTCAATGACGATAGGGGCCTCGTCGAACTGGTGAACAGGAGGGGGCGACGACAGACACCACTCGAGCGTCTGGTGGACCT
CCGGGATCACAACCTGGGCGTCCTCAGTGGGCGTGTTGTTAATGGGCACACCGTGCACCTTGCCGTCAGTGGAGAAACGGGCGACAGCGGGGCGGATGGC
GGACGTGGTGTTGACTGCAGAGAAGGAGGGCAACACGTGAGATCTCAGCCATTTTAGCTCGATTGGGCACGGAAAAAGCGTTCATCTAGAGGTGAGACAA
AGGAAAGACACATACCGGCCTTCAGGGCGCGCATAGACTGACGGATGAGGCTCATTGTGGCGAGTAAAAAGCTTACGGAAAGGTTTCTTAATCCGGAAGG
AGCTCTTTGAGGACTGCTCGTCTGGCGGTGGTGGCAACAAGACCCCCGAACACAAAGACAAGAGTTTTTGTGCGGAGGAGGGGCCTTCCCTTAATTTGCA
ACTATCCTCCCTTTTGTTTCTGACATTGAAACAGGTCTGGTGGCCCTAAATTCGCAACTTTGTGTTTGTCCGGGGACAATAGAGCGTTTCTGCGACATGG
TTGGTGGCGTAAAGGGATCAGTGCCACCAAAGCGTAATGCTTGCCTTGGTGTTGGGTACACGTTGCGGCCGAGTGCCAGCAAATTGTAGAATGAGGAAGT
AATGAGGGCAGCGGCAGGTTTCCTGGCCAAATTCAAAACTGTTCTCGCTGCATTGCCGCGGGATTTGACGCTGGTGGAAGCTGCGGCTGCACGCTGCGAT
TGTTGAATGGCGCAGCGTTGCTTCACCAGCCTTATGCTGTGCGAGCGTCGTTCATGGACGTGAGGACATTGCCAGTCTGCTTCTTGCATCCTGGTTGGCA
ACCAGTGGTCGAGTAAGAAAGTCCCCAGCGGTTACGCATTGATTCGCGTAGAAACGCACTTCTATTGGTGCCAGGTCACTTCAACTTCGTCAAGAGGGTA
TCAACACTTTGGGAACGTCGCTGGTAGTGCTGCTACTTACTCGGACTACTGTCACATATTTGTTGTCTTCGCTTCGGTCAACCTAAGGAGTTTGAAGCGT
ATGTGTACGATATGGGAGCTACTACATATCCTGAGTTACTGAAGTATGGTGCTCCTATCATTTACATTGTACATGTAGTAGAAAAGTTTTCGCGGAGACG
GCGTAATAAGCAGTAGCTTGAGGAGTTCAGACAGTTTCTGCATCGCTTTTCAATCGACCGTGCTGCAGAGTTCGGGAATTTGAGCTAGTTAGGGTGTCGA
ATATGAACAACAACAACATGGCTGTAGGTGATCGAAGATGGTTAATGCGCTGGTATGGGCGGAAGCTTCAAATTGGGCGTCAATTAAGCCAGTTCAAATT
CCGTCAATCAGGAATCGCACCATGCACTGTTTCCGCCAATCCCATCTCACTAAGAGCAGCAATCGCCCAAAATAGCTTTAAAACCTTGCTTTTGAAAGCT
GATCTCAGCCGAGGTTTTTCCGTATTTTGTCGAATGGGGCCAGGGCGCCGCGCTTCTCCACTCATTATTGGATTTAAATCCGCACGGCGCCCAACGAGAG
GAAGAAATCCCCCTTCCTGCAACCCGAGCCAAGCAGCTTCACTTCCGCTACACCGGAACGCGATGACACCACCCTCTGACGACGGCAAGCCGGCGGCTGA
AGGCACACCAAAGAGCGGCAGTGACCTGGCTCAACAGCAGCAGGCTCTCCTCCAGCAGCAGCTCCAACAGCAACAACTGCAGCTCCTCCAGCTCCAGCAG
CAGCAGCTCCAGAACCTGGCCAACCAAAATATGAGCCCCACCGAACTCGCGGCGCTGCAACAACAACAGCTCGCGCTATTCATGATGCCCATGTTTCCAC
TAATGATGCCGCTCCAGCAACAGGCGCTGGCCGCGGCCGCGGCGACGACTGACGGTTCAAATCCAGCCATCTCGACGTCCGAAGAGGCCGTTAGTGCATC
TACTGAGACTGCAGAGGAGGATGCAGCCGAGTCTGTGGCTACTGTGTCTGGGGGCGACGCCTCGCCAACGTATCAGACTGCGACTGCCGAGTCGCTGGGA
CTCACGCCGCCCTTTGTGGGCACCGACGGATTTGGATTGCTTGCAGGGACGCCCAGTATGGAGGAGATGCCTAAGCGCAAACGCGGCCGACCACCTAAGA
AGGACGTGGCGGCACGAGCCAAGGCTGAGATGGAAAAGACTCTGAAGCAGCAGTTCCCTATGTGGGGATACGGTCTGCCAATGCCATTACTACCAGGTTT
CCCAGGTATGTTGCCTGGCATGTCAAACCCGGGTGCTGTTGTCAAAGATCACTCTGCGGATGATGCGTTAAAAGACGAAGACGGGGATGGTGAACGTCCT
TCTAAGATGGCGAAGAAGAAGCCGCGGGGAACAGGCAAACCTCGAGGCAGACCACGCACGCGTCCTCGTCCCGGTGAGATTATTCGTCGAGTAAAGCCCC
TCCCTATTGCGCCCGCAAACTATTCGGTTATGTACAACTATTCTCTCTCCAACTTGGCACAAAAGAGTGCGGAGCTTAATGCCGATGGAACCTCAGCGGA
TACGGACACTACGACGATCACGGACGAAGCACAAGATGAGAACCGACTGGCGCCTCTGAGCGCGTCACTGCTGTCTGGAGAGCATGAGTAAGAAGATCCA
ACAGTTTTTAACTTCATCTGATAATTCGCAGTCGATAATACCGGTAGCGACTGCATTAATACTGTTTTCGTGCTACACAAATCAGTACAACACGGAGTGT
TGGTATGTGTATTCTAAAAATATGGTAAAAAATACTATTTTTACCTCTATATGATGCAGTTTGAGCGCCGAGTGAGCAAGCGGATAAATAAATAACGAAG
CTCGTGGCACTCCATGTGTATCTGACTGTTTGCTGGTCTAGAAGAAAACTTCTTCGTCGCCTTCGTTGCTCACAGCGTCACTGTCGTAGTAGTCGAAGGT
GTAGTCGTTCATATCATCACCCAGATCTTCTTCGGCGTCATCCATGTCGCCGTCATCGGCCTCGTTTTCGGCTGCCTTGGCCTTATCGGCTGCAATTTTC
TTCTCCTGAGCTTCTAACGACTTGAACACATTCTCGAATGCGCGTGGTTGCATGATGCCACGGTTCGTAGAGCCGGTGGTTGCTGTGCGCATTCCGCTGA
GCGAATTGGCACGCAACTCTTCGGGTACGTAGACCTCGTTAGCTTTCTGTGTTTCTGGCACTGTAACGTGTACTGGATCGGACGCATTGCGACCAGCGTC
TGGACCTGATGGATCCGCTTCCCACGGGTGGTAAAGACTCTCGAGCTTGTGTGCCAAGATGCGCTGTCTTTGGATCAAGTAGGCCTCGCGGTCGGCCAAT
GCCTCAGGTTGCGGCAGCTCCATGGGCGGGTACAGTGATTCGCCACCTTCAGCCTGTAGTAGTAGCAAAAATACGGTCAGTAATTCCAAGTTGATGATTG
GAGAGAGGTAAAGAGAGAGGTAAACGCCTACGTGCAGCAGCTCCATCTGTGTGTGCGAGAGGCCAAGGTCCTCACGCGTTTCGTCCATGATATCTGCCAG
CATTGAGTCTCGACTGCCACCGAAACGAACGCGTCCGCGGCCCCTTCCTCGACTCATAGCGACTGTCACGCAGCAAAAACAATTGCAGTGTGTGCCAGCC
AAGGATTTAAGAATATGCTATATCATAGGTTT