Description :
From Genome Similarity Track
Location :
contig_24:335185- 336828
Transcript NameFunction/comments
g4574.t1hypothetical protein PHYSODRAFT_505836
g4575.t1hypothetical protein AM588_10011715

Sequence
1643 bases(100 bases per row)
AGTGCTTCTCGAGGAAGACGCGGTGAATGAGACCCGTGCGATCGTGAAGATGCTCGTGAAGCTGCTGGGCCCGCAAAACGCGGTTTACTTGTTGAAGTTG
GTTTACGAGACGGTGAACAGTGAGGAAGCACACGACGCTTTTTTGCTGTGTCGTGACATTCTGCACGAATCGCTGGATGGAGACAACTACCGACATGCAG
GAGCGTCGGTGGGGATGCTACGGGCATTACCAGGGCGGTTCATGTTATGAAGGAGGCATACAGCGTGCTTCCCTCTTTTGACGAGCTGCTTGATGCCGCA
GCACTTGTTGCTGATGTTTCGGACGAGGTGGTTGATGGCGTTGCGCACGTTGTAACTGGGAAGAGGAATTCGAGGGTTCAAATGCGGGGCGAGTCGGATG
AAGAAAAGGGGAGCGCCCCTCGCTTCGAGTACGTGGGTGACGAAGACGAGGAGTCTTTGGCGCATGGTCTAGTGCAGCTCACGGATGAGACGTTTGAACT
CGAGGAAAGCAGTACATCTTCGGACGAGGACTTGAACTCCGTCCTCGAGTCGGGCATTTCACTGCTGACGCGAGTGTGCGACAGTGAAGAGGCCTCTTCG
CTCTTCAACACCTTTGGTGACTTTCTGGACGTGCTGGTGGACTAGGCTAAAGAGGTGGCGCTCCAACTGTAAGACACAAATGCTATTTATCCAGCTGCTT
GCACTGTAAGGAAACTTGAATGGGGGGCCGCTGGGAATATTTGTTTGCTCAGTGAATTGGACTCGTGAAGAACAGCTCCATCTCAACAGCGGGTGCGAGC
CAGAGGTGCTTAATCTGTCTGCTAAAACTTAGTGCTGTTGGCTTAGTACGCCATGTAAGAAAACCTGCTGGTAGTATTTGACTCCGTCATTGAACCATTT
TGGCGGCACAACTCAACCTGAAGAGCAAATGAGCAGGAGATTCGAGAGCTCACGATGCGGGGGTCAAACGATGACCAGCATCGCCTTATTAACGCATGCG
ATCAAGCGTTATCCCAGTTGCCGCGGGAATCTTTGGCTTGTCCATCGGAAACGCTGATGGCTGGCGTTCATGCTCGGTTTGTCGGACACGAAAGTGCTGA
CAACCACGCGATAACGTCTACAGTGGCGAGATTTCGCACGCTAATGAGCACGTGAAACGCTACCAGCCGCAGCGCCGTGAATAGCGACAGATTTCCCGAG
CAAGTCGTAGATTTCACCTCGATGAGGAAGCGTATCGAGCGATAGCACGTTTCATTGAACAATATCCATCACGGGTCGAGCAACCTATGCGGGTGTGTCG
GGACCCTTGGAGACCAGAGGAGCTGGCACGGGTAGCCGTGCAGTGAAGATGATATTGTCTCAAGTTGCGGTGAAAACCATGAATAAACAACTATTGCGAT
CCGTTTAAGATTGAAGCGGGGCTACAGCTGTTGATCCTCGTGAAGTGGAGCTCTGTTGAAGCCTGGTGCGGATACTATGGAGCGCATGGAGTTGATAAAA
GACACAGCGCGAGGCAAACGAGCGGCTGTATGGGAGCATGCTTAGCCAGCAATCGCGTTCGCTTCGCAACTGAAATGAACGACCAAAGGGTGAAGGGCAA
ACGTGTCGGTGAACAACAAGCAAGCATCAAGAACCAGCGGGTT