Description :
From Genome Similarity Track
Location :
Scaffold_49:335116- 337640
Sequence
2524 bases(100 bases per row)
ATGAATGAATGAAGCCATGGCTCGGCATCTGCTAAGAAAAGCATGCGAGGTTAACGGCTCTCTAAACATATCGAGATAACGCATTAGACATTGTTCACCA
CCCGAGCGATGTCCATCAGCCACAGGCAACAACGTCCCGGTGGTAGAAACCGAATACAGCGAGCTGAGAGCACGATTATTCTACATAATCGTAACAGATT
TAATAAGATTGGTCGTGTCGCAGCGTATCTCTAGTCGAAGATCCCGACGGAGTTTGACGATGAAGGTATCGATACTAACTGTCCGATATCCCGGACGTCT
AAGTCATGGAAAGTTACACTCAGCTGTCTTGGTGTCTCTCATTTCTTTAAGAGGTAGTTCGGATTCAGTAATTTGGGAACACAATCGTTATCCGACATCC
GGACGTGGGCCGCTGCCTCCAATGCCTCCTGTGTTGCACTCTTGAATACCCGGCCTCCGGGTATCTGTTTACGGATGTAATGCCCCTCCCCGTTACATAA
GTAGTTTCTATTAAAGTTTACATGTTACTAAAGTAGGAGAGCTACTTCCGGACTAGAGGATGTAGCATGTCGTGTGTCTTAGTGAGATTAATGAGGTCGG
ACTCATTATTAGCCAGTAAGATATCGACACGTAGATTAAGTGGTCCCCATGAGTCCAGGGAGCCACTCGTACTTAGGATCTAAAGAAACAAAAATATAAA
TCGAGTTAAATTTACTTAATACCTAAGACTTGGGCTTGAGTCTTCCTCAAGCGATAGTGTAAGCTAAGTACGGGTTGTTCTAGCCCCGTTACAACGGACG
ATTAACTAATTGGAGTCGGTATGATCGAGGTAATGGAGTGAGATCTCCAGATCATAGATGACTTGTCGATAAGCGAAACATTTTAGCTGTGCTGCAGAAT
TTCATATCATAAAAGGTAGGCACCCCTCTGTCCAGCGGTTGGTGGACGCAGCGGCCCAAGCAGCTGTCACAGCCAGCATGGATCCAATAATTCTACTATC
GGCTCTCGAGTCCCATACTCTTTGGAACGGTGAGCGTCAATAATTGGTCTATACCACTGGTCGGGCGAGCTCCGAAATACCAATCCCAAAACCCCTGCAA
TCCTTTAGTCAACCGCTAGCCAGCTCCCGCCCCAAAGCGACTCATTGTGGGTCTGCTATAGGTGCTATCGGACGTGAATACCGTGATCCGGACGATCACG
GAGCCGCATCCTGCGCCGTCGATCATTGATATGACAAATTTCGACTCTCAACGGACGATCCAACCATTACTTTCAACACCACGCTCGTCTCCATCCGAAC
AAGCCAGAAGGCAACAGGATTTATTTCGCAGGAAGGTACCCGTGAGCTCGACGCAGCTGACTCTGGAGAGCCAGGAACGTGTATAGTATCAGAAATTCCT
CGGCCGCACGAGCAACGTACCCAAGCACGCGAACTGCGGTCCACGAATGTTTCGAATGGTTTGAAGGGCAGGATACTATACTGAGGTTGTGCGAGGAGAT
CACGCCGGCGATTATTAAATGATTTGTGCTGGTATTGGCACAAGACTTAGCCAACGCAGCACTGGACGGGTCTGCTGTCAAATCCGAACGTTTCACGGCT
AGCACCACACATAGCATTCAGTAGCAGGGCTACTGAACATAAGGAACCCATGTACACGATTACGGATGACTGCAATCCTCAACTTTTACCGGGATTAGGC
TTCAATGTCTTAACGAAATTTAGTGGATAAATATTGTTGATATCACACGACTATGCCGCTACAACGGACTAGTGCTCGTATATAGGAGAAACAGATATAA
GAGGTAAGCAGTTACGCAATTGGAATGGCGGCCAATTTCCTCTACCGTTTACGTCTTCGATAGGGGAGACGAGGATTCGATAGACCAGGTTTACCGCAAG
TACTTTCCAACTGTCGAGAGTTGGCATAACAAGGCCGTGGAAGCGGCAAGCGAATATTTATTATCTCTATTAGCGTGCTTTGACGGTATATGGCGGCAAA
ATTGGATCCATCACGGAGCCATTTACTCGCACTACGGGCATAATACTCAGCCTTCTTTATTCTAATCGAGGGGCAGGACTATCAGACTTATCCTATACAT
CACTAGATGAAGAGCGGTTTTCGGCAACCCCTCAGACTGCTCCAGAGGTGCTCAGCGGGGCACAACTATCTTAGGTTCACGTACCTATTTTGGACTACAC
GAGTAAGCAGATGTGTCTTGCTGCCTCGCAGCTGAACTTATAGTCCAGCCCTACCAGCAAACAGCCAGTCAGGTGATAGTCCTACGCCTAAATCATGTAT
GAGCGACCACCGCCCGCAGGTTCTCAGTCACTATCGGCAGAAACACAAACGCGAAGAAAATGCCATAAGTACCGATGATCAACGCACAGAGGGTACCAGC
ATACGTAGAATAACTTACAGCGGCAATTGGACCGGGCACTACACCAGCCACGACAATGCTGATCTCGACACCGATCATACAGATAGTCCCATCGAACGCT
TAGAATGGCCGGATCTTTGGCTTT