Description :
From Genome Similarity Track
Location :
Scaffold_1000:3350- 7513
Transcript NameFunction/comments
Phymu_g12538hypothetical protein

Sequence
4163 bases(100 bases per row)
CCTAGAAGTACTAGGTCATCTCAAAGCCGGCGCCGGACGAGATGGAAGTGAGCAGCTTCGCTCGAAGCACCTTGTACGACGAGTACGTGGGCAACTTCAG
AGTGTTGAAGCACGTCGAGGAGCTCGGAAGCAGTTCGTCATCGCTTCGAATGGGGATTTTCTGCACGCAAAACTGGGGCGTAAGTGAAGCAAAGCCGAGG
GATGGGGCTCGCTGACAGCTTGTGGTGAAGCGCAAGAACGCAGCCTGCTCGGACGGCGTGAAGCTTGCCAGCGCCTGCCACAGCCATGCCACGCGCTTGT
CCAATGCGAAGTAGCCACCAGCGTATCGGGAGTTGGCCTtgaggtcgtccacgtcgattTTTCCGCTCTTGCCGGAGATCAAAACTTGCAGCTCAGGTTC
GTTGAACATCTGAAGCCAGCGAGAATCGATGAGGTCTGACAGACCCATCCGAAAGGCTGCACACTGTTCACGGATCTGAGTGTTGAGGTAGTAGTTGGCC
ACAAGATGGATGTACCGAGTCTTGTTTCGATTCGTCACAGGTACGTTGCCCCCTCCAGGAATGATCTCAATCTCCTTTTGCTCGCCGAATACATCTTGGA
CAACGGTGTGTGTCAGGCCTAGGTCCTCCACGTCTCCATCGTAAGACTTGAGGAACATCAGATTCTACAAAGAATTTCATTAACCCATTGTTTTTGCAGA
GGTTGAGGATCTCAACAGAAACGCACCTTGTAAATCTCTGGATCCAATGACGGAAGCTCATTTAGCTGGTTGAAGGAATGAAGAAGCTTGGAGAGGAAAA
AGTGGGCGAACTTTGGCTGAACCACGATTCCCTCGTACAGAGCTTTTCCCAGGATCCGACCGACAAACTGGAACATCGTTAAGTGGTCACTCTCGCGCGA
AAAATGGTTCGAGGCCGAGTTGGGGTTGGGATACAGCAGCTGGTCGTGGGTCGTGAGGAAAAGTCCATACTGCAGGTCAAACGCAAGCGTCGACAGGTCG
AGCCAAAACTCTTTGAAAAGTCCGCCAGCATCGATGCCCACTTCCTCGCGCCCAGCCGAGTTCACGAACACCACGTTGATCCGTTTCTTCAAGTTCGTTC
GGATTGAATTGAGCTTTCTCAATCCGTCTTCAAGGATGGCCCCGCGATGGATACGGATCCGATACACAGAGCAACCTTCGCTTTGGTGGATTTCCTTGTC
TGCTTTGATGAGACGCTGGAAAAGTTTAACACGGTCTGGGAAGGGGACAAGATAGGGCATCGACTGAACTAGCTTGTTGGCTCGAGGGGTGCCGAGCAAA
ACTTCTTCAATGAGCTGATTGCTATCGAGCTCGGCAATGATCCTGCGACGCACGAGTAGAAGTATTAGCTACCATCACATATCGGGAATGATAATCTTCA
ATCGACAACGTACCAGCTCGTAACATTGCAAAAAGGCTGGCGAGAGCATCGGTTGTACAGAACTCTCATCAAGCGAGTGGCCATTTCAACGACGAACATT
CCAAATGCCACTGATTCGGAAACTGGAGCGAGATTGGCGTAGTTCCAGTATGCCTCATGCAGTGCATGCTTCAGACTCAGAACGATCCGTTCGATCTGAC
AAAGAGGCAACGGGTACTCTTGTTCGTACATCTAGATGGGTATCACAACAAAGTTACTTCAGTGTACCTTGCCAGGACATTGAAAGACAAAACAACTCAc
ctcttcgtcatccatTACGACCAGAAGGTGTTCGTAAGACATACAGAAAAGCACCAACATGCACACATACGGATCAGAACTGCGCGCATGAATCAAATCC
ACATTCTGCCATGCATCACATCGTTAGCCAGTCACACTACACAGCACCAAGGAGGGGGGAGTTACCTTGGCAAAGTCCTCAAAATTCCTGGTGTCTTGCA
AGACGCACCACAGCATATGAACCAGAGAAACGCTCTGTACCGCATTTCCATCGCTCTCCACAAGCTCGACATGGTAGAAAGCCAGCGTATTCAGTAAGCG
CATTGCGTAGGACTGCCGCTTTCCGCCATCGTTTCCCCATCGAAAGAGGAAGGTACCGCACAGGCATGACAGGGCCTTAACGTTCTCCAAAATGAAAGGG
TGAGAGCTTGTCGACAGCTTCATACTCGCTGCACGCTGAACCGCAGCGGACGGTGGCTCCTTGGCATCACCAATTCCGTTCACAGCAATTTGGCGAGCTT
GCTTGGAGGTATTGTGTAGTTGACCAGCTTGACCAACACTATGATTCTCTTCCCCGTCTTCCCGTCGACGACGAAGTCCAGCCTTTTCGAACAAATTCCG
GGCCCATGTTGCTTTTCCAATAGATTTCATCTTCTGCCACGTTACTGAGAGAGACGTTGACaacgacgaagccgaagcaaTGTCGCCAAAGCCGAATTGT
TCCTAGAAGCAGAAAAGCGAATAAGCATCAGCTTGGTGGGCGACCTGGGGTTAAATGGGCGCACTTACCGCAATCGTTGGCGCTTCAGGATACATTGGTG
TCGGCCGTTGTGTTGCCAGCGGGTGACGAAGAGCACCCGGGGAAAAAGAAAGAAGGTGGTTACACATTGAGCGCAGGTACTGGTCATTAACCAAAATTTG
TAGCTGTTCGTTCAAAGCTTCTGGAAAAACCACGGGTACGGAGTGAGATTCGGATACTTTTGTCCACGAAACAGCCACTCCCGATGCAGCGTACGTTGCG
GGTGGTACGGACTGAAGGAGCTTTGAAAGGAGCTGGACTTCACTCAACACAATCGTGTCGGTTTTACCCTCCACGCTACTCATTAACAATGTGTCAGACA
CCCTATCTGATGGCCCATACAGCGTATTTGCAGCGACTTACCGATCAGAAAGCCAAAGGATGTTCCCGAGAAACCAAGCCTCAGACGCAATTCCAGGTAC
AGGCGAGACAGGGAAGTCGAACACTGACAAGCGCAGCCCAGCACTCAGCAGTCGATTCCATAGCGATAGGTTGGTGAGTTGAAGCAACTGGTCTGCAGCT
ACAACTTGGTTTAGAAGTGGCACTGAAAAAAACTGATAATAAAGATCACCAATGGTTAgaaattgaaaaaaaaaaaaggtaTGAGAGCGCTACTTACTTC
CATCACAAACGCCTCAAGGATTCCACTGGTTGTTGTGAGAAGATGCACTACAAAATCCACCAGACCATCACAGTACGAGGACTCCTGCACACGGGACGAT
ATTGGCAGCGACCCTCGCGATGATATTAATCCTTGTCGGACAATCTGGGTCACTGACGCTGTGGGCATCTCACTGTACAGCATTTTCCGAGGTTGTTGCT
CACGAAATACAAGCAGGTGACCCGATAGCAAGTATTGTTGCATCTCCGGCAGCGTGTCCATCAATATCCGTACAGTCTTAAATCCTGCACACACCTCCGC
TGCTGACGATGAGCTGCACTGTAGACACAAATCCACGAGTCGTCGCAGCTGCCAGTATCTTTGCTTCACGTGGGCTTCTTTAATCCCGTTAGAAGTTGCA
GCTAGAGCGTCTGCAAACAATGAACTCAGTTGCAACAGTCTctcagcgtctccttcacttcCACTGTAGAAGAAcacaagaagacgcagcagctgTAGCA
CAACAATAACACAGCGTTAGTTATTTTTCTAGACCCTGATTTCTACAGTTTTTACCTCGAACAACGCGTCATAAGGTAGCGGCATATTGGGCAGCTGCAG
AATGgccttcaacttcgagaTATCGCCCAATTTCTGGTCGAACTCGGCGCGCGAATGCGTTCGTTGTCTTCGAGCAGCGAGACGCCCACGTACAAAGGCC
CGCAGCTTCCGTgccgccgcctcctgctcctgtcgcCGGCCTCTCGCCTCTCGCTGCTCTCTCGCCAGCTGCAACACGCGCACGCGGTCGTCCCGCCCGC
CCCTGCGAGCCAGCTCATCGTCCCGCAGGAACATCCTCGCGTCTCTGATACTCCAGGGCAGTTTTCATACAAATcgtttttttattttcaaCCAATTGAA
TTCAAAAAATAAAATGGAAAGTTAGCCAATCActgcttcaagttgaagcgaccAACTACACAAGATGCACGATGGCATAAAGGATCGTGCCACATCCGAT
CATCAACACGGGCGTGTCCATCGTGTGCGGGGCCGTAGCCTCCGCGTACGCCATCGTCGGCGC