Description :
From Genome Similarity Track
Location :
Scaffold_3211:335- 2617
Sequence
2282 bases(100 bases per row)
CAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGTAAGACAACCCTACGGCCAGATCCAC
GATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCC
CACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAGCTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCTTACCGACGGGTACACAAGGTGAGGAAA
GTTCAGCAGAACACGGATCATCGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCC
GCTACACCACAATGGTGCGCGTGCCCGGATCGTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGA
GGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACCAGATCCGCGAATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTG
GATCCGGATCCGGATCTAGTAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATTCGCTAACAAAAC
AAGGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACTGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAA
GACGAAAACGAGTGAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGTTCAGGCTGGTCAGACAAGGATCTCGAG
TTTTTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGAGAGATCGAAGATCCAAGGGAACCGGTGA
GAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGA
TATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCG
GTGTCGTCGCCGAGGGTCAGCCAAGCTGCATCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAG
GACCCTCTGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCAGTAGGCCCTACGCGTGA
TCTGACACAATCCAGCCACGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCG
CCAGTGAACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAACGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTA
TGAGAGCGCCCGGGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTCGA
CCCAGATGATCTGGATGGCCCATCCACTTCGTCGGCGGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCA
GCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAG
CGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAATGGCC
AGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGCTA
GAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCG
AGACGGTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGCTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCG