Description :
From Genome Similarity Track
Location :
Scaffold_287:335- 1678
Transcript NameFunction/comments
Physo_125579hypothetical protein

Sequence
1343 bases(100 bases per row)
TTTGACAAGGCGCTGCTTCAGAGTTCTATTGAAGCGTTCAATTTTACCCATTTCGGCGTGATCTCCAGGCTCATTGTTGAAATGATCAATTTTCTTAGTT
TTGAATAATTTCTGAGCCTGTTGGTTCATGAATTCTGAACCATTATCGGTTGTGAGAATGTCAACCTTATGGAGGCGGACAAAAACCCTTATTGCTGCTA
GTACGGTCGGGCCAGTTTTGTTGGTTAGTAGTTTTGCGTAGCCTAGCCGAGAGTTGACGTTGATCGCAGTCAAGATTGGTCTTTTCTCCCAAAACGCCAA
GTCCATCTGCCACGAATTGGGGTTAGTCGATGCGACTTTGAACCTATCGTATCGCTTCTTCTGCTCCTGAAATCGCTGAATATCGCTCTGGTTTGAGTAC
CATTCCGTGACGATTTTCATCGTAATCTTCGGCTCCAGTTCTTTAGCCTTCTGGTATAAGGCTTGGGCACCCACATAGCCCGTTTTGGGGTCATAGTATA
ATATGGACAACAGCTGATCCATCGCTCTATATGGTTATAAAACAAAAAAATCCCCTGCCAGGTAGTTGCTTATATGTCGAGCGGTTCGGTGGTGATACCA
TCCGCAAGTACACGACGCTTGTCATAATAGTAGTTTAGAGCTGTTTTAGTCTGGGTGTACGTAATGATTGACTTACTCTCTTTACTGAGTCTAAACCCCT
TGTTGGTGCCCTGTAGCGTGATGCGATCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN