Description :
From Genome Similarity Track
Location :
Scaffold_77:334689- 337656
Transcript NameFunction/comments
Physo_139726hypothetical protein

Sequence
2967 bases(100 bases per row)
TTTCAACACTCCTCCACGCCGGCAGCGGCGACCCCCTCTTCGTCTCAATGGAGACCCACGATGACCCGCAGGTAAGCCAGTCTCGGTGCATCCAGGGCCT
TAGTGAGGACGTCTCCTGGCATCTTCTCGCTCTCGAGGTACTCGGCCTTGAGCACCCCACGCTTCGCCAGCGCGCCCACGAACTTGATGCGCACATCAAT
GTGCTTCGCCTTGCTCGATGAGCCTTCGCCGTCGAGCTGCTTGAGCGCCGCTTGATTGTCGACGCACAGCGACATCGGGCTGGCATGTGAGATGCCCAGC
TCGCCGAGCAGCTCGCGCACGCTCAGCAACTCCGTAGCCATAACCGAGGCCGCAGTGTACTCAGCCTCCATGGTGGAGAGGCTGACACCGGTCTGCTTCT
TGCAGACCCACGACACGGGCATCCCGTCAACCGTCAACAGGCCACCGGTCACGGACTTCCTGTCCGCCTTGTCGGCAGCGAAGTCCGCGTCGCTGTACGC
GATGACCTTCAGCGGCTCCTCCAAAACCCCCTGGCCCTTCATACTTAGCCGCAGGCTCTTGGTCCCTGCCAAGTAGCGCGCGATGCGCTTGCCGAGCTTC
CAGTCGGACATCGTTGGGCTGTGGGTGCGTCGCGACGCTTTGTGCACCGCGTACGCGATGTCCGGGCGCGTGCAGCGCGCCAGCTCCCCACGAGCGACTG
GCACTTGCGCACTGTCACCACGCCGTCTCCTCCAGACGTGGGCAGAAGTTCATCTGACGCTTCGTCGATCTCGTTCGACTCGGCGCCGATCGGGGTGCGC
ACGCCGTGCACTGTCGCCATCCCGTGCTCGCGCAACATCTCCTCGATGGCCAGCTCCTGGTCTAAGTCGTAGCCCTCGTCCTCGGTGTATGACACCCTCA
TACCGAGAAACTTGCTGGCGGGGCCGAGGTCCTTGATGGAGAGCTCGGCCAGCTCGCCGAAGAACGCGTCGACGGCTTGCTGCTGCATTCCCGTGACCAG
CACGTCGTCGACGTACACGCCGACAACCACCAGGATGCCCTCCCGGCGCCTGTGGTACACGCACATGTCCGTCAGACTCTGGGTGAAGCCCAACTTGATG
AGAGTCTTGTGCAAGAGCTGATTCCAGAGGCGGCCGGCCTGCTTGAGGCCGTACAGGGCCTTCAACAACTCCAGCACCAACTCGGAGTCATTCGCGACGC
CCAGTCGCTCGCGCACGTCCTCCGGAATCACCATTCCGCGCGGTAGGCGCAGATAGATGTCCAGCTCTGCCTCCTTATCGGCCTTGACGTACGCGTTGGG
CACGTCGCCGTGCTTCGCGGGGACTCCCCACTTCCTGGCGAGCACGAAAATCAGCTTCACGCTGCTCATCTCGATGACAGCGGAGAACGTCATGCTGTAG
TCGACCCCGAACTCCTGCTCGTTGCCGCAGGCGACGAGTCGCGCCTTCAGTCGCTCGATGGCGCCCTCCGCATCCATCTTAGTCTTGTAGACCCACTTGG
TGTGGAGCGCGTGGGCGCCCTTGGGCTTACGCACGACTCGCCAGACCCCGTTGTCTTCTAGAGCTCGCAGCTCCTCCGCCATCGCAGCAAGCCACTTTTC
CTTGAGCTTGCTGCGCATGGCCTCCTGGTACGTCTTCGGGTCGTGCTCGGTGACACTGTTCACGACGTCGCGCGCCGCCTCCTGCGACTGCGCGGCCCCG
TTCGTCACCCTGCTTGCGTTCTTGGTCACGGAGCGCGTCACGTGGCGCTCGCGCGCCCACGGCTTCTTCTTCTTGGACGCACGCTTCTTCTTGCTGCGCG
CGCTTGTGGCCTCAGCCACCGACGCTTGAGCTTCGCTCTCTGGCGTCTCGTCGCCTTCGAGCGTCTCGTCGCCTCGCAGGTAGAGCCTCTGCACTTGCAG
GTTCTGCTCCTTGTCGAGCGTCTCGATATTCTTGACGTGCTGCGTGGTCACCACCACCCTGTCCTTGGGCAAGTACACTCGGTACCCCTTGGTCTCTTCG
CCCACGCCCACGATCATGGCCGCCTGCGCGCGTTGCGCGAAGTTCTTCTTGCGCGGGTCGCGGTACACCGTGCACGGCGATCCGAACACCACGATCTCGC
CAAGCGGCGGAGACTTTCCCGTCAGCACCTTCAACGGCGACACACGCCCCGGGTTGGAGTTGGTCGGGGCGCGGTTCAGAATGTACGCAGCGTACTGAAC
CGCGTCACCCCAGAACCTCAGCGGGAGCCCACACGCGAAGATCATGCACCGCGCCATGTTCATGATGGTGCGGTGCATGCGCTCGGCCTTGCCATTGCTA
GACTGGTTCCGCGCCTCGCTGCGCTGCCTGGCCACGCCGGTGCGCTTGCAGAACAAGTCCACGTTCTCGTACTCTCCTCCGGAGTCGGTGCGCAGAACGT
GGATCTTGCAGTCGAACTCCTTCTCGAAGTAGACGAGGAAGTGCTCGAAGAGCTTCGCCGCCGCGTCCTTGGTGCGCGCCAGGAACACGCGGCAGTAGTT
GGACTTGAAGTCCACAAAGTTGATCATGTATCTGTTGCCCAGGCGGTCCTTGGGGGTCATCGGCCCCTTCAAGTCGGAACAGATCACCCCACCCACCCTG
TCGATGGGTGAGTGAGCGCCGGTGTCCTTCTTGGACCGCCGGTTCTTTGTCTGCTTGCCCTCGGCGCACGTCAGGCAGTTCACACGCTTATGGTCCGTTA
GGTGGATCCCGGAGCTCGTCTCCTTAGCCAGTCGCTCCACCGAGTCATAGTTCAGGTGCGCCAAGCGCTTGTGAAACTCCAGCAGCGTGCCTTTCTGCAC
GTCGCCCGATACTGCCGTAGGCTCCGTGAGCCCCTGGCTCAGCGCGGCCATGATCACGTCCGAGGGCAACTCATGCCTCGGCCCCACAGAGGCGCGCACA
ACCAACACGTTGCGCCGCATCTCGACGTCGAACGCCACGCGTCCACCGTCCTTGGCCGCAACGACGC