Description :
From Genome Similarity Track
Location :
contig_42:33468- 34572
Transcript NameFunction/comments
g9456.t1ETK87740.1 hypothetical protein, variant [Phytophthora parasitica

Sequence
1104 bases(100 bases per row)
CAAGTTTCGTCGACGCCGCCGAGTCCGCGAACATGCTGAGCGTAGTTGCCTTATCCTCGATCTTGCTGTGCGAGCCCGGCGCCAGCAACGCCACATCCAG
GTCACGCACTTTGGCCACACACACGCGACAGAACTTGGTCTTGACAACTTGAAATGTCTTTTGCGTGTCGTCGCCTTCCCGTGCGCCGCGGTAGATTAAA
CACTGGCGGCAAAACACCTCGCCGCAGAGCCGACAATGCTGGCGGCGGCGTGTGGTTGAGAAATCGCGCGAGCACAAGCGGCACTCGGAGCGCGCCTTCT
TGTCCGCCCAACTAGTGCGCCTCATCATGCCGTGCACCGAGATGAGCTTCGAGTCGACCCAAACGGCCATGTCGTTCATCTTGGTCATAAGTCTCTTGAA
GTAGAACCCGGGCACCGCGAAACCCGCAAAGTCGTTTTGACTCGTGAGGAACAGCTCTGTCGACCTAGGATCTCCGTCCGTCGGGCGTACGATAGACACG
ATGAGCATCTGCATCCGCTTGGTCTTCATTTTATCGGGCAGAGGCGGGCATTCCGGCAAAGTCAGCGGCATATTCACGCGCACGCCAATGTCTCGGCCCC
GCAGGTCCTTCGTGAAGGCCATGTACTCGAGGAAGCAGGTGTCGCGCTTCTTGACGAGTGCGAACGGCTGTAGACAGGTCCATTTGATGCCCAGGTACAA
GTACGGCTTGCCCGACGAGCTCGTGTGGATGTTTTTCAGCACGGCGGCGTCCACAGCGTTGCCGTACATGAACTGGTTCCAGGCGAAGAGCTGGCTCGAG
GTCTCTGCGTAGAAGAAGTTGAGGAAGTTGCGGTAGTCTCCTTGGAAGCGCCCGAAGATGCGGCATTGGCAATTGGCGGCGTCGCCCACCTGGCGTACGG
CGGTGAGGTCTGCGACCTTGCCCAGCGTCTTCCAGCCTTCGTCGTAGCTCGGGTTCGAGCCCATGGCTTCGTGTAGGTTGTAATCGGCCAGCGCGTTCTT
GACCGCGAGCGCCATCTTCTCCTCCAGTTCGAGCACCTGGAGCGTCGATAGCTTGACATCCGGGAAGTAGTCGTCGGGCATGGGAACGGATTGCTTGTTC
GAGC