Description :
From Genome Similarity Track
Location :
contig_42:33468- 34572
Transcript NameFunction/comments
g9019.t1POM57775.1 1-phosphatidylinositol-3-phosphate 5-kinase [Phytophthora palmivora var. palmivora

Sequence
1104 bases(100 bases per row)
CAAGTTTCGTCGACGCCGCCGAGTCCGCGAACATGCTGAGCGTAGTTGCCTTATCCTCGATCTTGCTGTGCGAGCCCGGCGCCAGCAACGCCACATCCAG
GTCACGCACTTTGGCCACACACACGCGACAGAACTTGGTCTTGACAACTTGAAATGTCTTTAGCGTGTCGTCGCCTTCCCGTGCGCCGCGGTAGATTAAA
CACTGGCGGCAAAACACCTCGCCGCAGAGCCGACAATGCTGGCGGCGGCGTGTGGTTGAGAAATCGCGCGAGCACAAGCGGCACTCGGAGCGCGCCTTCT
TGTCCGCCCAACTAGTGCGCCTCATCATGCCGTGCACCGAGATGAGCTTCGAGTCGACCCAAACGGCCATGTCGTTCATCTTGGTCATAAGTCTCTTGAA
GTAGAACCCGGGCACCGCGAAACCCGCAAAGTCGTTTTGACTCGTGAGGAACAGCTCTGTCGACCTAGGATCTCCGTCCGTCGGGCGTACGATAGACACG
ATGAGCATCTGCATCCGCTTGGTCTTCATTTTATCGGGCAGAGGCGGGCATTCCGGCAAAGTCAGCGGCATATTCACGCGCACGCCAATGTCTCGGCCCC
GCAGGTCCTTCGTGAAGGCCATGTACTCGAGGAAGCAGGTGTCGCGCTTCTTGACGAGTGCGAACGGCTGTAGGCAGGTCCATTTGATGCCCAGGTACAA
GTACGGCTTGCCCGACGAGCTCGTGTGGATGTTTTTCAGCACGGCGGCGTCCACAGCGTTGCCGTACATGAACTGGTTCCAGGCGAAGAGCTGGCTCGAG
GTCTCTGCGTAGAAGAAGTTGAGGAAGTTGCGGTAGTCTCCTTGGAAGCGCCCGAAGATGCGGCATTGGCAATTGGCGGCGTCGCCCACCTGGCGTACGG
CGGTGAGGTCTGCGACCTTGCCCAGCGTCTTCCAGCCTTCGTCGTAGCTCGGGTTCGAGCCCATGGCTTCGTGTAGGTTGTAATCGGCCAGCGCGTTCTT
GACCGCGAGCGCCATCTTCTCCTCCAGTTCGAGCACCTGGAGCGTCGATAGCTTGACATCCGGGAAGTAGTCGTCGGGCATGGGAACGGATTGCTTGTTC
GAGC