Description :
From Genome Similarity Track
Location :
scaffold_83:33463- 38340
Transcript NameFunction/comments
Pl_110181hypothetical protein PHYSODRAFT_472499

Sequence
4877 bases(100 bases per row)
TCGATGCGTTGTACCTCAGAACCCAGTCAACGGCATCTGGGAAGCCCGTGGCAAGATACGAGGGCGTGGGGTCTGCTTTTTATAAACAAGTGACTGAGCA
TGTCCGCTGCAGATAAGCGTAAACGGAAAGCAATAACGCACCTATCGTTCCTTCGTCGCCTGCCCTGTACTTGCCGGTCTGCACAAGCACTCCATACATG
CCCAATGCCATGGCACCATGCACGTCTTGGCGGACATCATCGCCGATCATCGCTGTATCAGCTGGAGCAACGTCAGCAAGTATCAGCGCCACGCTTGATT
GATACAGAACAGAAGTGACCGTACTCACATGTCCGTTAGCGCATGCTCGTAAAATGTCGGTGACGGCTTTCTGCAACCATGACGTGGTGTTGGTATCTCG
TCATGTCAAAGTGAGCGCATCACCTATTCACCACACTAGGACCCTACCCGATGATAGTTGCTTGGACGCCCGCTGAAAACTCAAGGGCCTTAACAAACGC
GCCCGGGCCAATATTAAGACCGGTTTTCCCAGCAAAGTACCGCGCTTCATGCAGTGCAATCAACGAGCCTCCATCAAGCAGGACGCGGAACGCTTCATTA
AGCTGTTCAAGAACAAACCATTACCATGTATCACAGCCAACCCTAGTCGAAATAAGAGCCACCATACCGTACCTTGTCGTAGTGAAAGTGTTCAGGTGCC
AAGCCGACAACTACTGCATTCGGGTTCGTGCGGTCGAGTCCGTCAAACTCTTCCTCAAGCGACGGATCTACCAGTAGCAGAGGCCGAAGGCTACGTTGCT
CAAGAACACTACGAGCGATGCCTCCCGATGTCAAAACATGCTCTGCCTTGATGTTATTGAGTCCGATGCGATGGAGGTGCTGGATCTGCGATGCATTTTA
GTGTTAAGCCCTTCCTTTCTCCGTCGCTGCTGAAGCGACGCACCAACTTGCGCCGGGATTTGCTCGTCGTGTTGGTCACTGCCATGAACAAGTCAGAAGA
GCACAGCGAGGATTAAAAGTCGGTCTTTCCAGCCAATTCTGTCTGTTGACGGACCGAAGCGCACGTCGATATCTTTGTGGGCCAGGAGCTTCGTCAGCGC
CGCCGCACAGCCTGACAGGACAGCGTCTTCCACATGTAGCGTACCTGGCCAGGAGAGAATGGTTAGAAGTTGAATGCAGTCTACAGACTGATGCGCACCG
CTCAGGTCGATGAGCACTCCGCGGATAGTGGGCATTTTATTGTATGAGAGCCGAACCTTCCGAACTGGGTTGAATCTATAGGATCGTTTTCAGGTTGAAG
TCCAGTGGAAACCTTCCACTAACCTTAGGCAGTTAACTCTCAAGACCGAAGTGTTCATGCTAATAAATACAAAGCCTCTGGTCGTTGCTCATTGCTCGCT
GACCGCCGTACAACTTTTGAAGCTGAAGCTCGCAGCTTGAGCTGATTTGCCTACTGTATCGCAACAGTCTGTCGTGACGCAAGTTGTGTCGATTCCTTAG
CCTCATCACGTATAAAGTCTTGTCTTGGCGCAGTGATCAGGATCAACCGGGTAATGTGTGACTTGCCAGCGAGAGATTGCGCTGTTGCAGTCGTTCTCTG
TCCACGCATTGAGCCTTGCAATCGGCAGCAATAGTGCCGAGTTGCATCTGTAGACTGTGTACCTGCTGCTCGTCATCGCTCTCACCTCATTGGCTACGAA
AATATAGTGCTATGCATACGGTGCACAGAAACACGGCTTCAGTCGCCATAACTCGATGTTCGAGCGCCATTCTTCATTTTTGAGCACGGTGTCCTCAAGT
CCGCGTAAAAGTGCAGGATCATTTCGCTGCTCGGCTAAGAATCGTCTTGGCGCATTCAAAATATTGGTACGTTTGTCGACAAGACTGGCCACATGTGTAC
GCGTCCGTTATGGACATAACTGTACACAGCGATTTTGACTTGTGTCTATTTGCCATTTCCAGACTCGAGACACGCCGCGATGCCGGCATCCAAGAAGCGC
ATTCAGAACCGCGGTACACTCAATGTGGGCACACAACAAGTACCAGCTGCATTGAAAGACTGGGTGCACATTTGGCACGGCGTCAAGGTGAACAACGGAT
CCGATGACACGTCCATTTTCCACGCGGGTTCGCGCACTGAGGAGATGCCGTTCTGGAAACAATTCATTCGACTTCCGTCCAATTCGCTGTTTCCAAGGGT
GTTTACTAGCTCTAATCCGAGAAAACCCTACAAGGATTTTCTCTATGTGCTGCTGAATATGCGCTGGCCCATGCTACTGACGGTGCTGTTGGCCATCTTC
ATGGTCAATATTTTCTTCTTCGCGGCTGTCACGTGCTTTATCTGTGGAGAACCGACCAACTACTTCGAGGCATTTGATCTGAGCTACCAGACTTTTACGA
CAATAGGATTCGGTGTCGTGTACCCCACACATACGTGTGGAAATGTAAGTATGTCGGTGGAGTCGTTCGCGTCTATGATGGTTGTGTCAGCTGTTACAGG
TCTCGTGTTTGCCAAGTTTGCCAAGCCACAGGCAAAAGTGGCGTTTAGTAAAGTGTGCGTTGTGCAACCGTACGGTAAAAAGTATCTCGCACTTGTGGTG
CGAGTTGCAAATGCTACTCAGTCACGCGATGTGACTCACGATGTGATCATGGAGGCTGTATTCAAAGTCAACTTGTTGCGTGTTGAGCACAAGACGAAAC
ACATTCGAGCTCATGATGACGAAGTCACCTTGAAGCGTAGACTTTCGCGACCAATGATACAAGATGCTGAAGATGCTGTGGACGCTGTGGATGATCTCGC
CTTTTCATCAACGAAAGTGCTAACGTCGTACAATCTCAAGCTACTACAGAATAACTTCATCACATTCCGAATGGGCGTCGCTGTGGTGCACGTGATTGAC
GAGAGCAGCCCGCTATATGGGATGTCCAAGAATGACATTGCCCAATCCGACATGCTTGTGGAAGTCGCGATGTCGGGCGTTGATTCCACTCTGCAGGATA
CAGTTTCCGAGCGGTACATCTACACGGCAGCAAATTTGATGTGGGGGTACCGCTTCGCTGAGTTGTTGGAGTTCAATGAGCGAAACGCAGAGGTCATCAT
GAACTTTGCCAAACTAAGTACAGTGGAGTCCGCCCCAATCGATGATGCAATCTACCTGAAACCAATATTCTCCAACGGGAAACCGCACGAATGTGGAGAT
AGTGGATATACACACAACATTGCCCACCGACGCTCACATCGGAAGTCAAGAGTATCTCACCACCAAGAGGAGAATCATCCATATCATGATGAAGCCATTC
ATGAAGTTCCATCAGAGTACTCGGAGCCTATTTTGTTGAGCTCTAGGTCAGGGTCATTGGACGGACAGTCGACTACTACAGATAATGATGTACCCGATCA
TCCTCACCCTCCTGTTACGTTCTCAAAGAAGTCTGGGCCAAAGAAATTTGCGATGGGGCTTGAGCCGCTATTCGAACCATTGCTACACCAACCGTTTGGA
ACGCAACGAATACCAAAAGCTCCATCTGCCGAAGCCCGAGCTGCTCATAAGGGAGGCTTGAGAGTTTGGAAAGAAAATGATCAGACCAATCTAGGGGAGG
CGCGACGCAGGCATACCGTGCAACAGATGACAACGCATGCCTGTCCAAATACGCGTACCCGCGACAATAGTGAGGCTGCTGTCACAAGTAAAGGCGGTCG
GGGCTCATTTGAAGGCCCCAATGGTGCCCGAGCCAAGGATATGCTACAACGAGAAATGGCGGGATCAGTGATGATCGAGGACGACGCCAGCACTATTTCA
CAGGAGGAGCACAGAGATGAACTAGCTGATATTGACAACATCGATGGTATCGAAACCATTGACGATGACTACGAGGAGGAGGACGACCAAGACGGTGTTA
ATCGGCAGTATCAACGAGCACATGCAACGTTGTCCGCTGTGTCAATAGAAGTCGAGGATACACCGCGCTTCTTGCGTATTTTGCCCGTCCATATTCCCAA
GTCGTTCAGCTTTATGAGGTTTTACCAGAGCGCTCTTCACGTTCGCTGGCCAAAAATCATTGTCGTGTTCGTGCTGTCGTTCCTGGTCATCAACTTTGTA
TTTGCACTGTTGTACTGGTTGGACGAGAACAACATCTCGTCATATAGCGATGTAATGGTCTCGAAATATGAGTTGGCGTTCTACATGAGCGTTCATACGC
TAGCCACTATCGGCTACGGGTCTATTGCGCCAAATCCCAATTCGGCTTACATGAATGTCGTCGTGTTCATCGAGTCGATGGTGGGCATCATTACAGTGAC
GATCATTACTGGTATCGCTTGGTCGAAGTTTGCTCGACCCAGAGCACACATCCACTTCTCGTCACAGATGACCATCTCAACCATCTACGGACACCGTTGC
CTCGTTTTTCGAGCTGCTAACACAAGGCACTCCGGTGAGGTGCACGAGAATTTCTTTCGCATCGGTGTGATCCTTACAAATCGGCGTACAGGACTACGTC
AGATGTACGACGTCCCTCTTGTGACTGCCGAGTGGCCGTCCATTAAGCTGCCAGCGACGCTCATCCACGTTATCAACGAAAACTCGCCATTCTACAAATT
TCAGTCGATAGAAGACCTATCGCAATCGCGAGTTGCAGTCATCGCTTTGATGACGGGGCTCGATACGACTTTCTCGGAGAATGTGTATGCGCGCAAAATG
TACTTCTGGGACGATTTTGCGTATGACATGCGCTTCGACGATTTTGCTGTCATTGAGCGTGACCGCGTGATTGTGGACTACAACCGCTTCGATCGCCTCA
TTCCTGAGGATCGAGACGATCAGGTTACCACTACACCAGTACTTTCAGTGAGGTCGTCAGCTGCTGACATAGTGTAG