Description :
From Genome Similarity Track
Location :
Scaffold_38:33460- 37911
Transcript NameFunction/comments
Physo_135369reverse transcriptase

Sequence
4451 bases(100 bases per row)
ACCTTGGTGTAGACAGACCAAAGACTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTTGGATTCCTATTGGCTGAGAGCAGCATCTCT
TAGCCAATGAGCGACATGCATAGCATTGGAATCCTGCTAACCAGCCGTTGGTAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAATATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTA
AACTAGGATACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCA
ACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTATGCCTGCA
ACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGA
TGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGCTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGCCGTCCGG
GACGACATCACGCGCGCAATCGCTGAAGCTCAATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCCCTCCTCCGTTGGCTTGTCGAACTCGACACTGCC
ATTGCGGCTCGACGTATCGACGTATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATTTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACG
CCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAGCATTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCG
GAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGG
CGACCAAGGTCGTCACGTTCATGAAGGGACTGAGAGATTGGCCTGTGAAGACCAATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATCACCCT
TGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCCTGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCCGAACCC
ATGGACCTCTCGGTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGCCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGG
ACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAATCCCCAGTGAGATTCATTCTC
GGTGCAAGAACCAAGATGACAAGCAAGACCTTGTCATCCTGAACGTAAACTCGATGAGAGCAAGCAGCTCTCTTCGCGCTTTGGTAGATTCTGGCGCGTC
GAAGAACTTTGTTCGACTGCGAAGTCTATCGAGGCTTGACTTCGAGGATCTAAAGATACCTCGAAGTATGTTGGAGGTACGACTGGCAACGGGTGCCGTC
GTGAAGACCCAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGACCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACA
TCGTATTAGGCATGCCGCGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGA
TGGCCCTGTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGA
GCACGCGCGCAAGAGCAGCTAGCGTCGGCGTTGCCGCCGACAGCTAATGAAGGAAATGTGTTGATCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGG
AAGAGTCTCCGGCCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCCGTTTTGGCCAAGAA
TAAGAGCCAAGGTGACGAGGCGCCGTCGACTCCGGGAGTCGATGGCTTAGGTGAATTTGATTCGTCGGCTCCGGGAGCCGACGCACCCTCTGTAATGGGG
GTCTCCGCCAATGGTTGGCGTCGAGGTAAGGATGGCGTGTCGACTCCGGGAGTCGACGCTGCAAGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAA
AAAACTTGCATGCTGTCGTGCACGACGAAGCGCCGGGCGACAAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATAAACCCGCCGGTGGTACTGAAGAAGA
ACACCCGTCCACGGCTGGGCCTGGGCGAGGTCAAGAACCAAGCGGAGCCGGGCTCCCCAAAACAAGAAGACGGCGCATGCGATGGTCGCTGCGCAAGTCT
CGGTCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTATCTGTGCCG
GGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTAATGAACTGGAAGCGCTTCGCGCGTGACTT
GCACGATGGATGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACT
GAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAGGAGCAGAGCTGGGACTCGTTGAAGACGAGTCCCTACTACGAGATCTTACGGG
AGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTGCCGGGCACGAAGTACTGTGT
CACGCGGCATTGACCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAGTCGAAGTCCCCG
CACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACTGGGCGGCTGGCGCATCGTTCATCCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAAGAGC
GCCCCTGCGACCTTCAACAGGTTCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGTACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTG
CGGACGGGATAAGCGATGTTGAGATGTGCAAGGTGCATCCCCGGAAGCTGCTTGCGCTCATGCGCAAGCAGAAGCTCTACGCGAACCTGAAGAAGTGCAT
CTTCGAGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGGAGGTCAGAGTGATCAATGAGTGGCCAACG
CCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGC
TCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGC
CGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTC
TACTACCAATCGTATCAGCTGAAGCCAGCGGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGT
ATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGTTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCT
CTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGAAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACT
GATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCGACGTCGTCACTGTTGGAGGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGA
AGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGG
GTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCC