Description :
From Genome Similarity Track
Location :
contig_47:334547- 339540
Transcript NameFunction/comments
g9704.t1ETM02862.1 hypothetical protein L917_00770 [Phytophthora parasitica
g9705.t1hypothetical protein

Sequence
4993 bases(100 bases per row)
ATACACGTTAGTCGGCATGCAGCGGCGCTGGACGACGCCGAGCTGGGGTTATGCCGTCGTGAAGCCCGTGAGGTCCGTGTCCAGCGTCGCGTACAGCATA
CTCTTCAACTCCTTCTTGCTGTGGTACAGCGGCAGATCCAGACGATTGAAGCATGCGTGACTCGAGATGTACTGCGTCGAGCGGTAGGGCACACCCTTGA
GGTTGAACGGGCACAGGCGACCATCGTAGCTGGTAAGACCCCGGAAACCCGACAGAGGGACACAGGCAGATCCTGTCGCGAACAGCAGCAGGCGTCGACG
GTACTCGTTCGGCATTTGGCGAACAATCTCCCAGAACCAGCGAGTTACGCTGACGCCCTCAAGGTTAGGAGACAATACGGTGTGAGTCTCCCAGTCCGTT
ACGTCCACTTCGGGGGATCCACACAGCAAGTAGTCGAATTCTTCTGGGTCAAAAATCAAAAGCATCTCGCGAGGAATAACCTCGTACAGACCCTTCAGGA
ATGCATGCAGTTGGTCCGCCACACTCTCGAAGAGCACGTAGCGGAAACGCCGGTCCAGGTACTCGCGCTTGTTGGCATCCGTGACAGCAATATCCCGTCC
ATTGGGGATAAGATCCACCACGATTTTCTCGGTTTCGTTTACCTGCTCGGTTAGACTAAAGTCAAGTCCGAGGTCGTCCACGCCGTCGTTGTCCATCAGC
CATCGGAGACTGCGGTACGCCTCTGGGTCGAGATACTCCATGTCGGCAAACGTCACTGGCATACCCAAGATCACCTTCAGCAACGGCAGTGCGAGATGAA
AGCCCCAGATGCCGCCTTCCAGCAGAGCCCGACCAATCAGTCGACCTGTGGCAAAATAGTAAGCTAGGTGGTCCTCGCCTACCTCAGACCGGGATTGCGG
ATTGAGAAAGTAGCTCTGGTCGGCCTTGTTGGTGCATGTAAAGAGTCGAAGCGTCGGCGAAGCCAGCAGCTCGTTCACCAGCATAAACCATTCGCGGTGC
ACCCCGCCAGCATCCACGCCGCTTTCATCCAGGAAATTGATGCGCATGAAGGAGCGCAAGTTCTTCGGCTGAATGCAGTACATGTGGTCCATCGACTCTT
CCAGCATGTACTCGCGGTGGACAGACAACTTCAAAAACTCCACTTCTGCAGGCACGATCAGCGAGGCCGTGCTGACCACAAAGTGCGCGTACTTTGAAGG
AAAGTCGCTAGTCGCCAAAGAAACAACCTCCTTGCGTCGCTCAGCCCCAGCATCGGCGAGCGTCGACTTCCCGGTCGCGAAGTCAGCCGGGTCCGAGACG
CTCGCCTCCACCAGCTCCAGCTCCACGTCCGTCGGCAGCATGGGCTTGTCGTCTGCATTTTCCTTCTCACTCTGCGGTTGCTCCACAGCCAGACTCGGCA
CTGGCTCCGTCTCCGTCATGGTTTCCTGTTCCTCCTGCTCTTTAGTCCTCTCCTGCTCTTGCTCTTCGGCCAGTTCCTGCTGTTCCACTTCCTCCGGGAG
CTTGAAACTCAGTGTATACCCCGGCAAGAGTGTGTCCACGTCGCTGTTCGCAGGCACGTGGCCTCCGCCTCCACTGCGGTACCAGAAGAGATTCCCTTCC
ACGTCCAATTTCCTCGTCCACTCTCGTCGGCTGCGCGCACGCCGCTGCTGGCGACTCAGCGACGACATTTTCCTCGGACGTGGCGACAGCAGGTGGGTCG
CGCTCATGGCCATGTTGATGGCTCCTCCTCTGCTGCTGCAAGTGTCCTCCGGCTTGAGCTGCTCGTCGTCGCTCTCGTCGTCGGCCGTGGCGAAGGACAG
CGACGGCAGCTTGTCGCCGCACAGCACGCAGTACTCGAAGCGCTTGAAGTTCTCGAACGCGCAGCTGGCGCACACGCTGTAGCCCGCCTCGGCTTCTCGC
GTGGCAGCGTCGATTCGGTGGTCGACCGACTCGCCCGACAGCAGCGGCACCTCCATGTCCAGCAGGTGGCGGTTGCGACGACACGCCATGAGCCACACCA
CGAAGAAGATGATGCACAGCAGCAGCATGCCCACGCCCTGGTACAGCATCGACGCCTCCGTGGACCGCTCGTTGTCCATCGCGGCGAGTCTTCAAGTGCT
GCGGTTCAAGTCAGTCACACGCAGAATGACCTTCGCTGAGGGATCCGTATTTTTCACTTGGTTTCAGTATTGCTAAGTCGCGTTTATGCACACTAGATTA
CGGCGACGAATCCCCTCGAAATAGTGACAATCCACTCACAGCGACATGTTGACGGGGCTTGCATGTTCCGTCACCGGTTTCCCCTAACGGCAATGTACCA
ACGTTGGTGCGCACCCGATGGCTCTGCTTCAAACCATGCGGTCAAGTCACTGGCTGCCGTTGTTCCTGCCAGCACTTGTGACGTCTGGATCGGCGATCCG
ACGCGTGCAATCGGTCATTGGCCTCTTGGTCAATGGTCGGACATCTGCAGGCGACCTGCACTTGCATTCCGTGAGGAAAACAGGCCGTTGTGACAATGCA
TCTCCACTGTCCTCCACGATGACGGCAAGACACGCCGCTCATAATTTGCAGTCGATATTTAGGTCTTTGGATACTCCACGCTGCCGACTTCCTACGCCGT
CGTGAACCCGTACGTCTCGGTGTTGAGCGTAGCGTGTAGCACCTCCTTGAGCTCCGCTCGCGATGATGCCAACGGCACGTCCAACCGGTTGAAGCATGCG
TGGCTTCGAATGTAAGGGGAGTGCACGCCCTTCAACGTGAACGGGCAGATCTGACCGTCGTGGCTCGTCAGGTGTCGGAAGCCACCGATCGGGACTCGCG
AGCACCCCGTTGCAAACTGCAGCAGGCGACGCCGGCACTCCAGGTTCATGTCCCGCACCAGCTCCCAGAACCACCGAAGCACTCGCGTCCCCGTCAAGTT
CTTGGAGCACCTCGTGTGTGCCTCCCAGTCCGTAACGTCGATGGAGTCGCAACCGCATAGCACATAGTCGAACTCTTCCACGTCAAAGAGCATGAGGATC
TGCCGCGGAATCACTTGGTACAAGCCTTTCAAAAACACGTACAGCTGGCTTGAAACGCTTTCTAGAAAATGGTAGTGGAGCCACCATTCTGCGAATTCGT
GCTTGTTTTCATCGGTCACCGGGATCTCGCCACCGTTTGACACCAAATCCACCGTCACCATGGTTCCACTTGCATCTCTGCGCGTTGTCGTGAAATCTAG
TCCGAGCGTCGCGGCACCATCGTGTTCCAACATCCACAGAAGACTTTTGTACGTCACCGGATCCAAATCCCCGTAGTCGCGAAAAGTGAACGGAATACCG
AGAATGAGCTTCAATAGCGCTGGTGCAAAGTGGAAGCCCACCACTTCGCCCTCTAATAGCGCACGGCCAACAAGACGTCCAACTGCGAAAAAGTACGCTA
GATGCTCCTCACCGATCGCCTGCCTCGAATTTACGTTGAAGAAATACGTCTGGGCCGCATGGTTCGTGCAGGTGAAAACCCCCAGAGACGGGTCAATAAC
CAGCTCCGTCACGAGCGCGAACCATTCGCGGTGCACCCCCCAGCATCTACAGCAGTCTCTGCAGCAAAATCAATTCGCACCACCGAATGGGTATCATTGT
CATCCATACAGCACAAGTACTCCATGGACTCCTCGACAACGTGTTCACGACGTAGAAACAGCTTCAGCACTTCCAGTTGAGGTGGGACAATCAGCGTAGA
AGTACAGGCCACAAAATGTGCGAACTTGGTTGGGAAGTCTTCTCTTGACAAATTGAGCAGGCCCTTGACGTCGACATTTCTGGACGAAGGTGGCCCCGTC
GCGAATGCTAGTGCGTCGGCTTCGTCGGCAGCCACAGTCTGTATTTTCATCAGCTTCGTTTCGTGTTCCAGCTTCCTAGTTACTGAACCAGGCTCTCCGT
CCGGTATCACGTCCACCTCAGTCTCCATCTCTCTGCCATCTTTGCCACCCCCTTCCTTGAACACAGCAACATATCCAGGATACTGGGAGCAGTTTTGAGA
CGCCTCCGCATTCCGATACCAACAGGCCTTTCCGGTGCAGTCAAGCTTGCGTTGCCATTCTGTTCGACGCCTAGCACACATCACCATATAATAAAATAAG
AAGTCAGCCTGCGGATCAAAGCATACACAACAAAAGACCAACCAACAACGCACTTTGCCCGCACTTGTCGAGCGGTAAGAGGGCTTCTTGCCCGAGATCT
CTCTGTCGGTGACAGCTTGAGCTTCTCCCCGCAAAGCACGCAGAACCTGAACCTCTGTGTGTTTGCGAATGCACACACTATGCATCGTACTGCCTCCTCC
TCTGCGTCCCTGCAAGCAACCGCCACCCCGTCTCAGTCAGCAGCGTGTCCTCAACACCCCAACCGACCTCCGTCAGCCCCCCATATCCTACGTACAACGT
TGCAACATCAATGCGATGCTCTCCGGTCGCATCATCTCTGCAGAAGCCACATTATCACAGCGTCAACACCTCAAAATATAAAAAATAAAAAAACAACAAC
AACGAGGAATCCGCCGCCTACCTGGCGATCAATGCCTGCTGCAACTCGCTGTAGCTGCGCTCGCGGTACTTGCGCTGCAGTTTGCGGAAGATGTAGGCGA
CGATAAGGTATAGTGCCACCTGGGAGGCCACGATGAGCACCACGATCACGTCCGCCATCTTCGGAGCTTTTCGCCTTCTTCAAATTGAGCACAATCATTG
ATGTCGATGATAGTCATTAATTCGAGGGGAACTCAACATCGATAGAGTCACTGAAGTGGTGCATACAACTATATCATGAGCGGCGCACTGAACGACAAGA
GCGCGCTGGTGCTGGAGCTGGGGGCACGTTACGCGCGATGCGGCATCTCTGGGGAGCGCGCGCCTCGCTGTATCGTGCGCTGGCAGGTGCGTTGTCACCG
TATTGCGCGCATCGGGTTCGAGGTTGCTCAAGGAGTATGTGGTCAGGTGGGGGACATGCTGCAGAAGCCCTTGACCGCCGCGGACTGGCGCCA