Description :
From Genome Similarity Track
Location :
contig_47:334508- 350554
Transcript NameFunction/comments
g9251.t1ETM02862.1 hypothetical protein L917_00770 [Phytophthora parasitica
g9252.t1GAY03874.1 Hypothetical protein PINS_011706 [Pythium insidiosum
g9253.t1XP_009523414.1 hypothetical protein PHYSODRAFT_313245 [Phytophthora sojae
g9254.t1hypothetical protein
g9255.t1hypothetical protein

Sequence
16046 bases(100 bases per row)
TTACAATAGGATTGCTATTGGGGGGTTCGATTATCCCCACCATCAGCTCGTAGATACACGTTAGTCGGCATGCAGCGGCGCTGGACGACGCCGAGCTGGG
GTTATGCCGTCGTGAAGCCCGTGAGGTCCGTGTCCAGCGTCGCGTACAGCATACTCTTCAACTCCTTCTTGCTGTGGTACAGCGGCAGATCCAGACGATT
GAAGCATGCGTGACTCGAGATGTACTGCGTCGAGCGGTAGGGCACACCCTTGAGGTTGAACGGGCACAGGCGACCATCGTAGCTGGTAAGACCCCGGAAA
CCCGACAGAGGGACACAGGCAGATCCTGTCGCGAACAGCAGCAGGCGTCGACGGTACTCGTTCGGCATTTGGCGAACAATCTCCCAGAACCAGCGAGTTA
CGCTGACGCCCTCAAGGTTAGGAGACAATACGGTGTGAGTCTCCCAGTCCGTTACGTCCACTTCGGGGGATCCACACAGCAAGTAGTCGAATTCTTCTGG
GTCAAAAATCAAAAGCATCTCGCGAGGAATAACCTCGTACAGACCCTTCAGGAATGCATGCAGTTGGTCCGCCACACTCTCGAAGAGCACGTAGCGGAAA
CGCCGGTCCAGGTACTCGCGCTTGTTGGCATCCGTGACAGCAATATCCCGTCCATTGGGGATAAGATCCACCACGATTTTCTCGGTTTCGTTTACCTGCT
CGGTTAGACTAAAGTCAAGTCCGAGGTCGTCCACGCCGTCGTTGTCCATCAGCCATCGGAGACTGCGGTACGCCTCTGGGTCGAGATACTCCATGTCGGC
AAACGTCACTGGCATACCCAAGATCACCTTCAGCAACGGCAGTGCGAGATGAAAGCCCCAGATGCCGCCTTCCAGCAGAGCCCGACCAATCAGTCGACCT
GTGGCAAAATAGTAAGCTAGGTGGTCCTCGCCTACCTCAGACCGGGATTGCGGATTGAGAAAGTAGCTCTGGTCGGCCTTGTTGGTGCATGTAAAGAGTC
GAAGCGTCGGCGAAGCCAGCAGCTCGTTCACCAGCATAAACCATTCGCGGTGCACCCCGCCAGCATCCACGCCGCTTTCATCCAGGAAATTGATGCGCAT
GAAGGAGCGCAAGTTCTTCGGCTGAATGCAGTACATGTGGTCCATCGACTCTTCCAGCATGTACTCGCGGTGGACAGACAACTTCAAAAACTCCACTTCT
GCAGGCACGATCAGCGAGGCCGTGCTGACCACAAAGTGCGCGTACTTTGAAGGAAAGTCGCTAGTCGCCAAAGAAACAACCTCCTTGCGTCGTTCAGCCC
CAGCATCGGCGAGCGTCGACTTCCCGGTCGCGAAGTCAGCCGGGTCCGAGACGCTCGCCTCCACCAGCTCCAGCTCCACGTCCGTCGGCAGCATGGGCTT
GTCGTCTGCATTTTCCTTCTCACTCTGCGGTTGCTCCACAGCCAGACTCGGCACTGGCTCCGTCTCCGTCATGGTTTCCTGTTCCTCCTGCTCTTTAGTC
CTCTCCTGCTCTTGCTCTTCGGCCAGTTCCTGCTGTTCCACTTCCTCCGGGAGCTTGAAACTCAATGTATACCCCGGCAAGAGTGTGTCCACGTCGCTGT
TCGCAGGCACGTGGCCTCCGCCTCCACTGCGGTACCAGAAGAGATTCCCTTCCACGTCCAATTTCCTCGTCCACTCTCGTCGGCTGCGCGCACGCCGCTG
CTGGCGACTCAGCGACGACATTTTCCTCGGACGTGGCGACAGCAGGTGGGTCGCGCTCATGGCCATGTTGATGGCTCCTCCTCTGCTGCTGCAAGTGTCC
TCCGGCTTGAGCTGCTCGTCGTCGCTCTCGTCGTCGGCCGTGGCGAAGGACAGCGACGGCAGCTTGTCGCCGCACAGCACGCAGTACTCGAAGCGCTTGA
AGTTCTCGAACGCGCAGCTGGCGCACACGCTGTAGCCCGCCTCGGCTTCTCGCGTGGCAGCGTCGATTCGGTGGTCGACCGACTCGCCCGACAGCAGCGG
CACCTCCATGTCCAGCAGGTGGCGGTTGCGACGACACGCCATGAGCCACACCACGAAGAAGATGATGCACAGCAGCAGCATGCCCACGCCCTGGTACAGC
ATCGACGCCTCCGTGGACCGCTCGTTGTCCATCGCGGCGAGTCTTCAAGTGCTGCGGTTCAAGTCAGTCACACGCAGAATGACCTTCGCTGAGGGATCCG
TATTTTTCACTTGGTTTCAGTATTGCTAAGTCGCGTTTATGCACACTAGATTACGGCGACGAATCCCCTCGAAATAGTGACAATCCACTCACAGCGACAT
GTTGACGGGGCTTGCATGTTCCGTCACCGGTTTCCCCTAACGGCAATGTACCAACGTTGGTGCGCACCCGATGGCTCTGCTTCAAACCATGCGGTCAAGT
CACTGGCTGCCGTTGTTCCTGCCAGCACTTGTGACGTCTGGATCGGCGATCCGACGCGTGCAATCGGTCATTGGCCTCTTGGTCAATGGTCGGACATCTG
CAGGCGACCTGCACTTGCATTCCGTGAGGAAAACAGGCCGTTGTGACAATGCATCTCCACTGTCCTCCACGATGACGGCAAGACACGCCGCTCATAATTT
GCAGTCGATATTTAGGTCTTTGGGTACTCCACGCTGCCGACTTCCTACGCCGTCGTGAACCCGTACGTCTCGGTGTTGAGCGTAGCGTGTAGCACCTCCT
TGAGCTCCGCTCGCGATGATGCCAACGGCACGTCCAACCGGTTGAAGCACGCGTGGCTTCGAATGTAAGGGGAGTGCACGCCCTTCAACGTGAACGGGCA
GATCTGACCGTCGTGGCTCGTCAGGTGTCGGAAGCCACCGATCGGGACTCGCGAGCACCCCGTTGCAAACTGCAGCAGGCGACGCCGGCACTCCAGGTTC
ATGTCCCGCACCAGCTCCCAGAACCACCGAAGCACTCGCGTCCCCGTCAAGTTCTTGGAGCACCTCGTGTGTGCCTCCCAGTCCGTAACGTCGATGGAGT
CGCAACCGCATAGCACATAGTCGAACTCTTCCACGTCAAAGAGCATGAGGATCTGCCGCGGAATCACTTGGTACAAGCCTTTCAAAAACACGTACAGCTG
GCTTGAAACGCTTTCTAGAAAATGGTAGTGGAGCCACCATTCTGCGAATTCGTGCTTGTTTTCATCGGTCACCGGGATCTCGCCACCGTTTGACACCAAA
TCCACCGTCACCATGGTTCCACTTGCATCTCTGCGCGTTGTCGTGAAATCTAGTCCGAGCGTCGCGGCACCATCGTGTTCCAACATCCACAGAAGACTTT
TGTACGTCACCGGATCCAAATCCCCGTAGTCGCGAAAAGTGAACGGAATACCGAGAATGAGCTTCAATAGCGCCGGTGCAAAGTGGAAGCCCACCACTTC
GCCCTCTAATAGCGCACGGCCAACAAGACGTCCAACTGCGAAAAAGTACGCTAGATGCTCCTCACCGATCGCCTGCCTCGAATTTACGTTGAAGAAATAC
GTCTGGGCCGCATGGTTCGTGCAGGTGAAAACCCCCAGAGACGGGTCAATAACCAGCTCCGTCACGAGCGCGAACCATTCGCGGTGCACCCCCCAGCATC
TACAGCAGTCTCTGCAGCAAAATCAATTCGCACCACCGAATGGGTATCATTGTCATCCATACAGCACAAGTACTCCATGGACTCCTCGACAACGTGTTCA
CGACGTAGAAACAGCTTCAGCACTTCCAGTTGAGGTGGGACAATCAGCGTAGAAGTACAGGCCACAAAATGTGCGAACTTGGTTGGGAAGTCTTCTCTTG
ACAAATTGAGCAGGCCCTTGACGTCGACATTTCTGGACGAAGGTGGCCCCGTCGCGAATGCTAGTGCGTCGGCTTCGTCGGCAGCCACAGTCTGTATTTT
CATCAGCTTCGTTTCGTGTTCCAGCTTCCTAGTTACTGAACCAGGCTCTCCGTCCGGTATCACGTCCACCTCAGTCTCCATCTCTCTGCCATCTTTGCCA
CCCCCTTCCTTGAACACAGCAACATATCCAGGATACTGGGAGCAGTTTTGAGACGCCTCCGCATTCCGATACCAACAGGCCTTTCCGGTGCAGTCAAGCT
TGCGTTGCCATTCTGTTCGACGCCTAGCACACATCACCATATAATAAAATAAGAAGTCAGCCTGCGGATCAAAGCATACACAACAAAAGACCAACCAACA
ACGCACTTTGCCCGCACTTGTCGAGCGGTAAGAGGGCTTCTTGCCCGAGATCTCTCTGTCGGTGACAGCTTGAGCTTCTCCCCGCAAAGCACGCAGAACC
TGAACCTCTGTGTGTTTGCGAATGCACACACTATGCATCGTACTGCCTCCTCCTCTGCGTCCCTGCAAGCAACCGCCACCCCGTCTCAGTCAGCAGCGTG
TCCTCAACACCCCAACCGACCTCCGTCAGCCCCCCATATCCTACGTACAACGTTGCAACATCAATGCGATGCTCTCCGGTCGCATCATCTCTGCAGAAGC
CACATTATCACAGCGTCAACACCTCAAAATATAAAAAATAAAAAAACAACAACAACGAGGAATCCGCCGCCTACCTGGCGATCAATGCCTGCTGCAACTC
GCTGTAGCTGCGCTCGCGGTACTTGCGCTGCAGTTTGCGGAAGATGTAGGCGACGATAAGGTATAGTGCCACCTGGGAGGCCACGATGAGCACCACGATC
ACGTCCGCCATCTTCGGAGCTTTTCGCCTTCTTCAAATTGAGCACAATCATTGATGTCGATGATAGTCATTAATTCGAGGGGAACTCAACATCGATAGAG
TCACTGAAGTGGTGCATACAACTATATCATGAGCGGCGCACTGAACGACAAGAGCGCGCTGGTGCTGGAGCTGGGGGCACGTTACGCGCGATGCGGCATC
TCTGGGGAGCGCGCGCCTCGCTGTATCGTGCGCTGGCAGGTGCGTTGTCACCGTATTGCGCGCATCGGGTTCGAGGTTGCTCAAGGAGTATGTGGTCAGG
TGGGGGACATGCTGCAGAAGCCCTTGACCGCCGCGGACTGGCGCCAGTATCTGTATCCGGAGCTGCACACGCTGTGCTTCGAGTGAGTGGTTTGGATCTG
CATCGACTGCGTGGGTTGCGTAGCTAACAGGCTGCTGTACTGTCAGCTTGCTGTTGGTGAATCCGACGCGTCGCCGATTCGTCGTGTGTGAAGATCTGCT
GCTGCCGCGGGTATTCCGGGAGACGCTCTTGAGCATTTTATTTGATGTTCTCAAGGTGGTTATTGGATGGGAATAGAGAGTTGTGGTTTGGGGGGCTGAA
CAGGAGGGTATTGTGGTTGTGCCAGGCTTCTGCGGTGTCGTTGGTGCCGTCCATGATGGCGGTGTTGTACGGTACAGCAAACCACACAGCTTTGGTGGTA
AACTGCGGCTGGGCAGAGACGCGACTGCTGCCTGTGTTCAAGGGTATACCGCTCCCTTATCTTTACGAGAGTAAGTTTGGTTACTAGAAGCTGTGGAAGA
ATGTGGAAGTGACGCGACGTGGTGTTGCTGTGTTGAAGCTGTGCCTGCTGGAAGCCGGAACTGCTGTGAGTTGATTCAGCGAGAGCTGAATACGTCTCGC
GACCAGCCGATGGATAGCTTGAAGACCGTTGTCACGCCTGTGACTGAAGCCATTGCAGAAGGCATTCTTGAACGGGCGTGCTTCGCACAGCAAAAGGTAC
ACCAGGAGAGACTTCATATTGCCGAAGTTATATATCGCGGAGCTCATGTTTCTGCTGTTATGTGCTTCGTGGATCAGAATCCGTTGCCAAATGTGGTTGA
CGCAGAGTTTCAGACCCACGACAATGATGTGCTGCAGGTCGGTCGCAGTAGTAAAGGCTTCATTTTCACTCGTTGCAGATTCTGACGGTGTCTCACTTGG
ACCCTACTTGCGTAATAGGTTCCTGGAAGCTTGCGCACTGGAGCCGTAGAGCAGCTACTGATTGGTATGCATTCGTGGTATCGGATGGCCTGCTGCAATT
CCTAACACATCGAATTCACCTCGCAATTCGATTGTTCAGGTGACGAAAGCACGGATGGGATTTCAATTGTCGACGGCATCATCCAAGTCTTGAAGAAGGC
CCCGCTCGACGTGAGAGCAGCAATGCTGGAGAACCTGCTGCTTGTCGGAGGAACCGCTATGATTCCTGGTAAAATTACCGTTCGGGTAAAATGTTGGTAT
ATTCCTTTGCAGCCATGCTAACCTGTCTATGCTTCAGGCTTGGCGCAGCGTGTCATGGATGAAGTACGCGAGGCTCTACATCATGATAATGAGTTTGCCT
CGGCTTCGGCTGCTGTTGACCGAGCGCAGCTCGTTCAGACATACTTCCCGCGGAACATGCTTGCCTGGGTTGGCGGATCAGTATATGCTGCCACGGAGAG
CGCTCGGCTCTCGACTATTTCATCGCAAGAATACAGCAGCTCCAACGGCACCAGTATCCCTGACTGGCTCACTGTCGCTGAAGAGGGATTCTAAGTCGAA
AGTGACTTTTGCAGCGAGTATGTGCCAGTGACGGAGTACGTGCGAGGATTTGAATGGTTAGTGTATTTCCTATTGCCGAAATTGTTGAGCTATGAAGTGA
TTAACAAACCTTCGTCAGCATGTATGGCACCATGGCTTCGTAAGCGAGACGGCTTTAATGTAGCATTTTAGCCGTCCGACTTACTTACTCGTTCGCATTC
CGAGTGGCTTGCCAGTGTCGTCCCATGGTGCCTTCATGCCAAGATCAGGCATGTTTTTGAGATTGGTAGTCGCGGCTCCACTAGGCCGCTTCAACGGAGC
GACGTGATGTGGCAGTGCTGACTTGCGTGGTTGCATCTCTCTCGCCACCTTTGCGTCTGCGTCTGCCGACAATTTCACACCTTCCTCGCGTCGGTGTTCC
TCCTTGGAATCGGCTCGGAGTTGACTCTTGGTGCGTGATGTGATACAGTCGACTGCTGCGGCATCTTCCTCCTCGTCTTCGTCAACAAAATCGTTGTCGA
CCTTCCACAGACTGATGCGGCGTAGCTCTTCACAGCCACGCACTCCATTGCGATACGTCTTGAGCTGGATACCTTCCTTCTGAAGAGAGACGTCTGGGAA
ATTGGTGTCAAGTAGCGGCTGCTCTTCCTCGCCATTTTCAAGGTAGACGTAGAAAGTGTAGTCATAGTATAGCAGCACAAGCACGACGCCTCCAATGTGG
ATCTTGCTCGCAATAGCCTCCACATCCTATGCAGATCAAGCCCAGCAACGTTGAATGAGTCGTGCAGTTAATGAAGCATGACACTACCAAAGTGAACTGA
CCTGGAATGCAGCGCATTTGCCCATGGCAATTTCAAAGAAGCACTCAACATTATCATCCTCAAGCCAGCTTCCAACGTTGCCCGGGCTCTTGACGAACGA
CCCCCCAGTTTGAGCCAGTGTTTGCACGAATTGCTCTGCCTTGGACATCTCTTCCTGCATGGCAGGCACAATTCCTGCCAAGTGTTCCATCGACGGGGTA
AATAATGATGTCGCTGGCATCTTGGAGACTTCGCACATAAAGGTCTACGAAAAGCAAAATTGACACACGATGAGTAACACCGCGAGCAGAATGAAACTTG
ACCACTCGAACATTACCAGAGCACTTTGCTGTCGTCGAAGCATGGGGATGATGATAGGAATGTCTGACAACTCAAGCTTTGGTCCCAGATCCACGTGCCC
GTTGTAGCACCAGTTGCCAAATCGGAAGAGCACCTCGCGCAAACTCGGGGTGTTTGTGGAGCCTTCAGCACGAGGGGTGCGCCGAATGAGGAAGGTCTGG
TTGTAACCTGTGCCACTGACATCTTTGCATTGCACTTTCAGTGGCTTCGGTGGGCTTTTGTGTTTTCCGATACTAGCCGCCTGCCACAGCGTGAGCTTTT
TCATGTTGCTGCAGTCGTCCTCACGGTATGTCTGCAAGTGGATGCCCTGAAGGTGAGCCGAGAGGTCCGGGAAACGCACATCGAGCAGAGGCTGCTCGCC
GTCTGCTTCCTGCAGCACGACGTAGAAACTACGTTGGTAGTAGATTACCAAGAGCACCAACCCACGCACAAAGGTCTTGCTGGCCACGATGTCCACATCA
TCGAAGCATTCATAGCCACCGCTCTGCAACTCGAAAAAGGTCCTCGATCCACCATCGTCCAAATCGCCGTCCACCCACGTGTGCTCCTCTGCAGCTTTCA
TCAGCTTGCGTTCAATACGCTCGCTTGAAAGCTCAGCGCCGATGAAGTCGTAGACATCGTACAGCGTTTCAAGAGGTGTCGAGTATTGAGACGTTGAGGG
CATGGCCTTCCACTCGCAAATATATTGTAGCGAAGCTTGCTGCTTCTGTAGGGCAGGTACGACCACCGGCAGATCGGCGAGCTCCAGGTCGGCACTACCG
AGATCGACCTTCCCGCTGTAGCACCAATTGCCACAACGGAAGAGAACTTCATGAAGGTTGTTCTTGCTGGACCGGACGATGTACGTCTGGTTGTATCCGT
CACGCAGTGCCACAATCTCCGGGGTCGGGGCTCCCGAGTCGTCCGCGTTGATATCGGCTTCGTCGGCCTGCGCCTTGGACAAAGGCTTGTGCATGGCCTG
GGTTCGGTCGGCGTTGTCCTTGGCCTCCATCGTTGCGGCCTTCGCTGGTTCCCTAACTGAGCGAGAATGGAGGGACGCCAAGATCTTCGGTTGCGAAACT
ATCGTGGTCTCTAAAATGGGACGCACTTGCTGCATGTCAACTCGGAGCATGGCTCGAAACGAATGCAAAGTTTTGTTGTCGCATGTACGGATGATTATCT
ACACGGTGAAGCTAAGCTGCAGTGCGCAGTCTGACTAGTATGTGCAATTGGCTGACGCTCTTTCAGTTGTGGCAAAGCTACCACTTGTGCTGCTGGGCCC
ACGCACCGGTCACCTTCGGGCCCGCAGGTGCAGCAGCACTAGGTGCCGAGGGGGCAGCGGGCTGGGTAAGTGGCTTAGCCCACGCGTTTCCAGTCGACTG
GGAAGACTGTGGGGCCGGAGTGGGAACACCACCGGGCGGCGGGCCCCACGCAGCGCCAGGGGGAGGAGGCGGCGCCTGGCGACGGACTTGCGGGTTTTGA
ACGCGTGCGTGGCGACCACGCATGATGGCCTGGATCTTGGTAGCTGCCTGCGCATCTGTCAACGGTAGAGCCTCCGGGAAGGCCGTGCCGATCTTCGTGT
CCTTGCCCCGGCCGAAGCTGAAGCACTTGATGTTGCACAGGTACGGGCCGAGCTGTACGTTGTTGTTCTCCTGGCCGTTCAGGTAACACATGGTGTACAG
GGCCATCTCGAACTCCGGGCTCACTCCGATCAAGCTGCAAAATGCCACCACATAGTCGTTGTTAGTCACGTTGAATGTAGAAACCTTGATTGCAGTAGCC
AAGTTTCACCTCGTGGACACGGGCTTTATCTCGTCTTCCCACTGGAACTGGAACGTGATCAATTGCTCCTTGTTGTGGGGCTCCATAAACTTGCATCCGC
GCTGCTTAGGGCGAATGTATCCCCTGTAGTCGATGCGGCCGTTGCGCTCCTCGTTGTACACCTGGAGCCAATTGTGGCAACCGCACACTTTGCCCTGCTC
GGCGAACAAATCCATTAGCAACAAGACTAAATCCACTGATCAGATAAATCATCAATCTCACATTCTTCTCCTCGCCAACGAACACGTGCTCAAAGCCCGA
CGAGTCGTTGCGCACTTCACGGCGGTACAGCCCGAACCAAATGAGCTCGAGCTTTTTCTTGAAGTCCCCCATGTCGCCCGTGAACTTCTTGTTCTTGACC
AGCCAACTGCAATTGACCGCATACAGTCAGAACTACATCCACACCCTCACCGCCATCACCGCCATACTCACGCGTGGGCATAGCGCATGGGCGCCGTCTC
AAGCACAGCGTTCAGGAACGCGTTGTTCTCCGCCAACTCCTTGGGCGTCACGCGCTCCGTCACACCTGTCTGTGTATCACAAGGAGCCAATTACCACATA
ACTCCAGTCACGACTCCACTCTGTTCATTGCACTCTCCAAACTGGTCGCACCTCGCGCTCGTAGTTGTCCAGCAGGTCGAAGAGCAGCTTGTACGTGCGG
CGCTCGAAAACGCTCGGGTCCACGAACGTGAAGAGCGGCTCGCGCGCCGCGTCACCGCGGGCGTAGGAGGTCTTGCCCTCCTGTAGGTTCACTTCGTAGT
GCACGTTGGGCTCCAGACGGTTGGTGTCCAGCTCCCAGAGCTTGTTGCACGCGGCCGAGAGGCTCTTGAGCTCGGCGACTGCAACGGCACAAGTCAGCAT
TATATAGGATTTCTCAGCCAATTCATTGCAATTCGCCTACAGTCGGAGTGGCGTTGGCCATGATGCAGGGGCTAGCGACTATCAACGGCTCGAGGCGATC
GGGGAATGAATTGCATCCGTCCTGCAGCTGGATCGAGCGCACCCACACGCTGTCGTCAGTTGCTGGAACGAATGATACATGTACACACGACTGCAACCAG
CGAATCAGCGTCGATAAAACAGCTGCTGCCACAAGACAAGAAATATGCCAGCCAATCAGTGTCGTCACAACGACAGCTGTATATACTTGAGTACCCGCAA
GATACTCGCCAAGATACCTTTTGCTTTCATGCCTTGCTCGTTGCTGAGCCCAGTTTTCCTCGGCAGACTAAGAGCAGGTCTCAGACTCACGCACTCTTAT
CTGCAGCATCCAAATTGTTAATTGGCAAGCTGAGTGTCTTGGTTGTTCCGCTCAACGCGAGCTATCTCACCGTGAAGCGGGACGTGCAGCTCAAACTCAA
AACTCAAACACGGCATCGCAGATACCACGCCTCGATATAATCGGTAATCGGTGACTTGCAGGCGACAACACGGCCCTGGTTTGACTATCAAGCAATGCAT
GAGATTCGACCCCGCCTCCACAGTAACGCACTGAGGATACACGTGGAGCGATGGAATTAGCCGCCGATGCGATCGCGCGGCGATTGACACGGGAGCGTCT
AAGGCATCCCGTTTAACAAGCCGCTAGCGGCAATGACTTGTGCTTGCAGCAATATCTACAAGAAAGCCTTGTACATGCTCGACTTATAAGTGATGGCGCG
CAGCGTTGCCTTGCAAAGCACGCCTGATGGCTCGAGAAGCACTGAGGGCCACAAGCAAAATGCCGAGCGCACCAGAAACGGATGTCCGTACCTTTGTAAC
GAAGGCTTCAACACTCTCTTGTCCGATAACCTGGCCTCCAGAATCTTCAGTTTGGCTGCATTCAAGCCAGATACACTCGTCTTACATCATTTGCCTCCGA
TCTTTCATCCTTTTCAGCATCGTTGGTGGTTTTGCAAGGCCAGCCTCGATGATGTGCTTGGCCTTGCTTGGCGCCGCTCACCCGCCACTCTCGCACTCGC
CTCGCCGCGCCCAGAGCTCCGTCGTCTCCTGCCTCGCCCCAGCAGCTCCATGTGGCTCCGTCCCGGCGTCCTGCACACGCGCAGACTGCTCTTCTCGTCC
GCGTGCGGTCGCTCGCGCTCGTCTCTGGGCAGTCTGCGCGTCTTCACATCCGCCCGGGGGGCGTTGCAGGCTGCCGCAGCGCCGACTGCCCCCGTCTCGG
AGCCCCTGAGCGGCGGGTACCCCACGACCGCAGGTATGAAGCCGCCCGTGGACGACCAGCACGCCGTCATCGCCGACTTCATGCCCATCGTGCCGCCCGA
GTGTCTGCGCGTGCAGCAGGCCGAGCAGACGGCGCGTGGCGCCACCGTGGGCCCGTCCTCCTTCACGTCCATGTTCCGCGACATGTCGCCCTACATCAAC
TTCCACCGGGGCACGACCATGGTCATCCACCTGCCCGGCCAACTGGTCGAGTCCAACCTCTTCGGCGCCGTGATGCACGACATCGCGCTGCTCAACACCT
TTGGCATCAAGTTGGTGCTGGTGGCGGGCTCGCGGCCGCAGCTGAACAGGCAGTTGTCGCTTCGCAAGCTTTCGCAGAGATTCGACTGCGGCATGCGCAT
CACGGGACCCATGGAGCTTCAGTGTGCCATGGACGCAGCCGGCTCCGTGCGCTTCCAGATCGAGAGCTACTTGGGACGAGGAATTGTCAACTCGCCCGGA
CGAGCGAGGACGATCAATATTTCTTCCGGGAACTTCATCACTGCGCAGCCTGTTGGCGTTCGAGGAGGTGTCGACTTCAAGAACACAGGAGAGATGCGAC
GACTGAACGTCGATAAGGTGCGCACTGCACTGGATGGCGGAGACATTGTGCTCATCTCCAGCATCGGCTACAGTGCCAGTGGTGAGGTTTTCAACTGCCT
CTCAGAGCAGGTGGCGAGCAAGTGTGCCATCCAGCTCGAAAGTGCCAAGCTTATCTTCATGCATAACGGCGAGGAGCTCATCGACTCGCGATCCAACTCC
ATGGTGCAGACTCTTGTGATTGAACAAGCGCAGCAGTATGTCGAGTTGGCGCGCCAGAACACGGACATTAGCGGCGATTTCCTGCTGTACTTAAAGGAGT
CTATCAAGGCCTGTGTGAACGGAGTCAAGCGCTCACATCTTGTCAGCCGACACGTGGACGGCGGCTTGCTGCAGGAGCTCTTCACCCGCGACGGCGAAGG
TCTTATGATTACAAAGCACATGTACGAAGGCATTCGGATGGCCTCTACCAACGACATTGTGAGCGTCATGCGCCTCATCCAGCCTTTGCTGGACGACGAC
GTGCTGGTGTCGCGTGATCAGGAGCAGATTGAGAGCAACGTGGACACGTTCACGGTTGTGGAGCGCGACGGTGCGATCATCGCTTGCTGCACACTGCAGC
CGTACGAGAACAACTTCGCCGAGATGGATGCGTAGCCGTCGACCCGACCTACCGCAACCTCGGCAAGGGCAATGCTTTGCTAGGATATATTATGCGCAAG
GCAGCAGCCATGGGCGTCACCAAGCTGTTCGTGATGACGACCCGAACAGCCCACTGGTTCCTGGAGCGCGGCTTCGTGGAGGCTACAGTGAACGATCTGC
CTCCGTCGAAGCTGGCCAAGATCGACCTCAAGCGCAAGTCGAAGGTCTACATTTGCGACATCAGCACGAAGAAAGCTCTAGACGAGAAGGAGCTGCTGCT
TCAGATGGAATAACTCGGTGCGCTGCCAATTTTACGCTCGACCGACTTTTTGCCTATCGGTCGGCACCGCGATTCCTTAGAGCGGATGCAGGAAAGCGAG
CAAGCCAGTCATATTTAACTCACAGAAAGCTGCTCGGACATTTTCCCTCCCAGTCGTTCCCATGACTTCCATCTATCTGTTGACTGACGCTACTTGGCAA
GGCCGTCTCGCGTTTGGCAGGCATAGCCTGTGTAGCCTTGAAAGCAGGTGCAGGTTCCCGCCTTGTAGTTACACACACCGCGGTTGGAGCATTCTACGAG
GCACTTATTCCCTGCAGCGCCAACGGCAGTGCCGCCAGGAACAGTCTTTCCCTGGCAGTTGGTTTCGTCTACAGTTGTGTCCGGGTCGTCTCCGATGGGG
CAGTGTCCTGTTGAAGTTGACACCAAGTTGAAGTCAAGCTGAAAGTCAGATGAGTGCAGGTCTTTGAGCAATCGTACGTTTCGAGCAGTCCGCGCTGAAA
TACTCCGTGGCTTGCAGCTCGCCGCTCGCCGCCCCGACAGCCCAACCAGAGTCGCAGACACACCCAAAAATCCTATCGGCGTCCCAGGTCGCGGAGAACT
GCAAGCGACAGACAAAATGGTCAAGGTCGTGCTCCAGCAAGCAAGTTTTGCTAACGAACGTACCGGTTGGCCTCCATAGGTTGTTGCCGCAGAAATGGGC
AGTGCGTTTTTGGCGGCGGCCATTTCGCGCATACTCATGCAAGTGCCTCGGTCTGAGCAATCGTTTGGGCAGCCCACTACATGCACACAGCAACAGGCGA
CAGTGGCGGTGAGCAAAACCATAGTCTCACAACAACGAAACACGTACTTCTCTCGCATGCGGAGCCTTCAATGCCAGGAAAGCACATGCAGGTCCCAGTG
CTTCGGTCGCAGATTCCCATGCCTGAGCACTCTACTAGGATGTCATGGGCAGTGACAGTGTCCGTGGGAATGGAGCTCCACGCGTAGTTCGATGGGCATA
CACCTGCATACATGGACGCCAGGTTAAAATGTTGACCTCGTCGGCACGAATCTGCTTCACATACTTACGCGTAGAGCAGTCTGGTGATTTGTAGTCTGCA
ACGTCCGTCGGCGCACCCCATCCAGTGCCACAAATGCACACTTTTGATAGCAGCGTGCAAGTACCATGACCACTGCAGTCGTTTACGTACGTGCAACCTT
CACCACCGATGGTGCTGCTCTCTTCGATGGTATTGCCGCCCGCATCTCGAGTGCGCACAACAAAGTTCCCAACGGCCGAGTTAGGAGGTGTGGTGATCTG
GTCGACTGTAAATGAGAGACCAGTGCTGGGCAAGATATTCGTGCCTGCAATCTTCAGTTTCACTGAGCTCGATGTCGCAGTGAGCACGGAGCTGGCAATC
GGAATCCCAACCAACGAGCCTGCGACGAGCGTGGCAGCCCCGACACTGTAGCCATCAGGAAGCACAGCCTCAATGTAGCCGCCAAGAGGGATGGTCGCGA
CGGTGTCTACTGCCACAGTCGCTACTGTGAGTGTATCGGGGGACCTGAGTAGCGGACGCACGCGGCCGTAAGTAAGCGGCTTCTTGACGATTGGCGTACC
GGGTATTGTCGTTAACTGCTCGAACAAGTTGCCCCCACTGTCGGTGATAGTCACAGTGTACGTCTCCCACGTCATCGCGCAGTATTCCACGATGAATTGG
TCGCACGAAGTTCCGGGATTCGTAATGCCCTCCACAGTAAATCCGCGGCCAGTTCCTGGGACTACAGCAGTGTTTCCTGTTATCATTCGTGTCTTGGTTG
AACTCACCGACCCGAAAACAGTGTTCACTGTGGGTAGGTTCGTGGTATGACTGAAAGTTACGGCGCTAACGTCGTACCGGGCCGGAAACGTAACATCAAC
TCGACTACCTGACGGCAAGTAGGCCGAGTTGGCAAACGCAACAGTGTAATCCGTGACAATACCGGCCCAGTAAGATATGGGTGTCACCGTCGCCGATGGA
AGCGTTGCGCTCGTGTAGGTGAGCCCAGCCACTGCCTGGTTTTCCTGGAATATGGCCCCGGTAGGGTGCCGTGTGTGAACTCCAAAAACTCCCGAGGCTT
GAGCCGCCGGATTGATAATATTGCCATACGTGATCGACACGCTCGTTCCGGCAGCAACGTCTTGGCCAGCAATTGTAAGGCGGATATAAGGCGAAGCCAC
TTGCACTATCGTCGAGGCTACAGCAATGCCTCCCAGACTGGACAGTGTCGCGCCCGTGAAGACAATTGTGCTGGCACTGAGAAGCGGGAACTGCAGTGCA
ATCACGCTCCCAACGCGTAGTGTGATGCTCGTCGTGAAGGAGATACTGTACGCTGTCGTCGTGCCGGCAACCAGTGATGCCGCTGTCACTACCGGGCTGG
AAATCGTTCCTAGAGTGATCATCGATCCCGGTACAGTAGCTGACTCGAGGGTCGAACCGCTTGCACTTTGCGTGCGTATCAAATACGTGGAGGTTGTGCC
CGAGCCTGTAGTGCCTGTAGCCAAGTTGGTTTTACATCCTATTAGTCTTCGCAGCTCAAAAACCTCCGTGTGTCATTCGTTTTACCTGGATTCGAGATAC
CGTCGAGAGTGAAGGCGATCGGTCCAGCAGTAGCGTCCGTACCGGCCACCGCGATCGTGACTTGTGCGCTGGCAGGTGTTGCTACCATTGAACTGCTCAA
GTCCAATCCCGAGGTGATCGTGAGCGTCGTGGAGGCTACGTAGAAAGTGGAGGGGAACATGACCGTGATCGTTCCGCCGACAGGGACGGTAGTGCCTGTC
GTAAAGGCCACGCCCACATTACCCGTGACGCCAGCGACAAGAGACGCAGGTGTGATGGTCGCAGGCGCGATGGCTGCATATCCTCGCTCTGCGCATGACA
GCCACAGCAGCAATTGCAGCCACCACATCGCATCCACCCTTTCAAG