Description :
From Genome Similarity Track
Location :
Scaffold_2028:3345- 6289
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2028-fgenesh-gene-0.2Trafficking protein particle complex subunit 2
Pytiw_DAOMBR242034maker-piw_contig_2028-fgenesh-gene-0.1Dynein light chain/pantothenate kinase

Sequence
2944 bases(100 bases per row)
GCTTCCATTCGCGCTTTCACTTCGCGAGCCGTGCGGATGAGGATGTTCTCCTCCAGTTCGCACTCGGCCTTAAGCTGCGCAAGCCGCACCTGCTTGTAGT
ACTCAGCCTCCTGTGCTCGCCGCCGCGTCCTGGTCACGAAGCTCTCTTTCTGCGAAATTGTGGTGGTAGTCTCTGGCCTGGCCAGTAACATCACCTTGCC
TTGCTTTGGAGCTCGACCTTCATCGTGTCTCGTATTGTTATTGTCACTAAGGTTGCTGTTCCGAGTAGGACCTTGAGCTGCTGCTCTTGGTGTCTTCTTC
ATCATGACGCCTCGAGCTTCACTCTCATGATATGTACTCGTACCAGAGCCTGGAGCCGCTGAGATCCTGAGCTTGCCCACGACAACGCCATGCGGCCGGC
CAGGTATTGAAGCTGAGGTTGACACCAGCGCTCTCAGCCGCTCGATCTCCAGTCGGTACTCGTCTATTTCGACCTCGAGCTCCTGGTATCGAAGGAATTT
GCTATCCGCATCAACCAAAGCCTGAGTATTACTGGAATCATCGCTAAGCATAGCCACATTGACAGTACCTGCTGTACTTGAGTCGATCAAGCTCTTTCTT
GCGCTCTTCGGCTATCGCTTCAGCGTTTACGACCTTGGATTTCCACCTCACGTTAGCCCAAAGAGACCTGTTATTACATACACACAGAACAAGTGCAGCT
CCATGGTATGAGAATCCACCTACACGCTGCTGGTTCTCCATCACGAGGCGGTCGATGAGCTCCTGCTTGAGCTTCTTCGTGAGCTCAGCATCCTGCGGCG
CGCGCAGCACCGCAAACATTGCTTGGAGCTGTTGTTTCAAACAGGAATATGTTATCACATACGCATGTGAGCACCGCTTGCAATGTGTATAGCTACTATA
GAGAAAGAGAGCAACGTACGTCTTTGTCTCTCTTCTGCAGCGTCTCCTGCAGCTTGCGCACCTGGGTCTTGAGCTGCAGGATCACATCGTCCTATAGCAA
TAGCAAAACCACAATGCACGTTCTCTTGTGTCAGTACATACGCATACACATACGTATGAAGCGTATACAGCGTGGCTCAGCTCACCTTCTCTGCGATCTG
CTTCCGTGCAGCGCCCAGGTCTTCCTTCGTGCGCTCCCATTCGCGCCGCTGCTCCTTCGCCTGAGAACGTCAGCCAGCCACATCATCAGTCACACACACA
CACACGTGCATATACAGCAGCTGTACGCACCAAGAGATGGTCGTATGCGCCAGCAGACGCTCGTGCAGCATGAGCCACAGTGTCCACGCAGCCTCTGCCC
ATCAATCACGCCTTCGTGCACTTCTTTCGCGTCTTTTCAGGCTCAACGTTTTGTCTTGGTTAGATACGCGTGGACCACATCAAATGAGTCCATATAGAAA
CGATTTTAAAAATAGAAACATATGTTGTTTCTAAAAGACGCGAAAAGTCGCGGATCCTACTGAGCATGAGCAGACCCAATGCGCCAACACACCCGTATCA
AGCAGCAGTGACAGCATCAGCACTACCACTGCTACTACAGCTACACACAGGCGGCAGCTAGCGAGGATCACGCAGCAGTACCACCACCAGCAGCAGACGC
ATTCCAGTAGCAAGACATGGGCGAAGCGCCGAGCTGGCAGCACATGTGGGGCGCGAAGGTCAAGATGCCGTGCGACATGGAGGACGACGTGCTCGAGGAC
GTGATCAAGCACGTGACCAAGTGCCTGTCGTCCTTCGACACGGAGGAGTGGGAGAAGCAGGGCCTGGCGGTGCGTGTTGCTTCTCTGGGTACAACAAGAA
TGCGTTTGGCATGGCTATCTAATGTGTCATGTGCATACGATTGCTGCCTGGTGCTGATGATGCAGGTCTGCGAGGAGCTCAAGGCGCACATGGACGAGCT
TTGGGAGCCACACTGGGTCGTGTGCATCGGCAGGAACTTTGGCTCGTACGTCACGCACGTCACACGCAACTTTGTGTATTTCTACTTCAACGAGAAGGCG
ATCATGGTCTACAAGGCAGGCTGAGGCAGCTCATGTAGGACTGCGACTACCATAGCCAGTCGAACACAGTGCGTGTATATGCTGGTCCCAGCATATACAC
TAGTCATGGTCGAAGCCAAGCGATGATGAGCTGCTCATGTAGCTTCGTGTTTGTAATTTACACCTCCATTTGGTATTTTATCTGCCTTCAAAAGAAAATA
TCGAGCCAAAAAGTCCCGTAATTTATTCTTTTCGTAAACTACATGCCAAACGCGTGATGCCCAACAGTTTTTTTTACTGACACGCTTTCCGAAAAGGTAC
AAAGCGCAACAGCACCGAGGAAGGACAAGGACAAGCGCTCTTCTCACAGACGCTCTCTCTCTCTCTCACAGAGACTCATACAGACAGACAGAGAGCATGG
CGCCCGCAGCGAAGAAGATGAAGACGGAGGTCGGCGCGGTCGCGTTCGCAGAGCCAGACGTCCAAGAGGAGCTCAACGAGAATGAGAACGACGGCTCGGA
CGACGAGTCGCCCATGTCCATCATCGCCCAGTTCCAGAGCGAAGACGTACGAGCCGCTTGCTTGTTCACGTGGACAGTGGTGATAGGCGCTGTGCTGATA
TTGTGTGACGTCGTGTATCACTTTACTTGCTGCTGTTTAGGGTACGAGCGTCGGGCCGCAGTTGGACATCCCGCTCGGCTCGAATGTCAACCAGATGGAA
GTGCTCGTGAACGAGCTCCTGCAGGTGCGCTTATCCTATTGATGCGTCGTCTACTGTATGCATGCAGAGCATCACCTCACACACTCGTACTCTCTCGCTT
GGTATCATAACAGAACGGCAAGAACAAGGTGCCGTACTCGCTCTTTGTGGGCGAGACGGAGATCACAAAGTCGCTCCAGGCGACAGTCGAGGAGCTCAAG
CTCTCGACGGAAACCGCGCTAACAATCACGTTCCAGCCGCTCGC