Description :
From Genome Similarity Track
Location :
contig_47:334497- 339490
Transcript NameFunction/comments
g9251.t1ETM02862.1 hypothetical protein L917_00770 [Phytophthora parasitica
g9252.t1GAY03874.1 Hypothetical protein PINS_011706 [Pythium insidiosum

Sequence
4993 bases(100 bases per row)
AAACGCTTGTTTTACAATAGGATTGCTATTGGGGGGTTCGATTATCCCCACCATCAGCTCGTAGATACACGTTAGTCGGCATGCAGCGGCGCTGGACGAC
GCCGAGCTGGGGTTATGCCGTCGTGAAGCCCGTGAGGTCCGTGTCCAGCGTCGCGTACAGCATACTCTTCAACTCCTTCTTGCTGTGGTACAGCGGCAGA
TCCAGACGATTGAAGCATGCGTGACTCGAGATGTACTGCGTCGAGCGGTAGGGCACACCCTTGAGGTTGAACGGGCACAGGCGACCATCGTAGCTGGTAA
GACCCCGGAAACCCGACAGAGGGACACAGGCAGATCCTGTCGCGAACAGCAGCAGGCGTCGACGGTACTCGTTCGGCATTTGGCGAACAATCTCCCAGAA
CCAGCGAGTTACGCTGACGCCCTCAAGGTTAGGAGACAATACGGTGTGAGTCTCCCAGTCCGTTACGTCCACTTCGGGGGATCCACACAGCAAGTAGTCG
AATTCTTCTGGGTCAAAAATCAAAAGCATCTCGCGAGGAATAACCTCGTACAGACCCTTCAGGAATGCATGCAGTTGGTCCGCCACACTCTCGAAGAGCA
CGTAGCGGAAACGCCGGTCCAGGTACTCGCGCTTGTTGGCATCCGTGACAGCAATATCCCGTCCATTGGGGATAAGATCCACCACGATTTTCTCGGTTTC
GTTTACCTGCTCGGTTAGACTAAAGTCAAGTCCGAGGTCGTCCACGCCGTCGTTGTCCATCAGCCATCGGAGACTGCGGTACGCCTCTGGGTCGAGATAC
TCCATGTCGGCAAACGTCACTGGCATACCCAAGATCACCTTCAGCAACGGCAGTGCGAGATGAAAGCCCCAGATGCCGCCTTCCAGCAGAGCCCGACCAA
TCAGTCGACCTGTGGCAAAATAGTAAGCTAGGTGGTCCTCGCCTACCTCAGACCGGGATTGCGGATTGAGAAAGTAGCTCTGGTCGGCCTTGTTGGTGCA
TGTAAAGAGTCGAAGCGTCGGCGAAGCCAGCAGCTCGTTCACCAGCATAAACCATTCGCGGTGCACCCCGCCAGCATCCACGCCGCTTTCATCCAGGAAA
TTGATGCGCATGAAGGAGCGCAAGTTCTTCGGCTGAATGCAGTACATGTGGTCCATCGACTCTTCCAGCATGTACTCGCGGTGGACAGACAACTTCAAAA
ACTCCACTTCTGCAGGCACGATCAGCGAGGCCGTGCTGACCACAAAGTGCGCGTACTTTGAAGGAAAGTCGCTAGTCGCCAAAGAAACAACCTCCTTGCG
TCGTTCAGCCCCAGCATCGGCGAGCGTCGACTTCCCGGTCGCGAAGTCAGCCGGGTCCGAGACGCTCGCCTCCACCAGCTCCAGCTCCACGTCCGTCGGC
AGCATGGGCTTGTCGTCTGCATTTTCCTTCTCACTCTGCGGTTGCTCCACAGCCAGACTCGGCACTGGCTCCGTCTCCGTCATGGTTTCCTGTTCCTCCT
GCTCTTTAGTCCTCTCCTGCTCTTGCTCTTCGGCCAGTTCCTGCTGTTCCACTTCCTCCGGGAGCTTGAAACTCAATGTATACCCCGGCAAGAGTGTGTC
CACGTCGCTGTTCGCAGGCACGTGGCCTCCGCCTCCACTGCGGTACCAGAAGAGATTCCCTTCCACGTCCAATTTCCTCGTCCACTCTCGTCGGCTGCGC
GCACGCCGCTGCTGGCGACTCAGCGACGACATTTTCCTCGGACGTGGCGACAGCAGGTGGGTCGCGCTCATGGCCATGTTGATGGCTCCTCCTCTGCTGC
TGCAAGTGTCCTCCGGCTTGAGCTGCTCGTCGTCGCTCTCGTCGTCGGCCGTGGCGAAGGACAGCGACGGCAGCTTGTCGCCGCACAGCACGCAGTACTC
GAAGCGCTTGAAGTTCTCGAACGCGCAGCTGGCGCACACGCTGTAGCCCGCCTCGGCTTCTCGCGTGGCAGCGTCGATTCGGTGGTCGACCGACTCGCCC
GACAGCAGCGGCACCTCCATGTCCAGCAGGTGGCGGTTGCGACGACACGCCATGAGCCACACCACGAAGAAGATGATGCACAGCAGCAGCATGCCCACGC
CCTGGTACAGCATCGACGCCTCCGTGGACCGCTCGTTGTCCATCGCGGCGAGTCTTCAAGTGCTGCGGTTCAAGTCAGTCACACGCAGAATGACCTTCGC
TGAGGGATCCGTATTTTTCACTTGGTTTCAGTATTGCTAAGTCGCGTTTATGCACACTAGATTACGGCGACGAATCCCCTCGAAATAGTGACAATCCACT
CACAGCGACATGTTGACGGGGCTTGCATGTTCCGTCACCGGTTTCCCCTAACGGCAATGTACCAACGTTGGTGCGCACCCGATGGCTCTGCTTCAAACCA
TGCGGTCAAGTCACTGGCTGCCGTTGTTCCTGCCAGCACTTGTGACGTCTGGATCGGCGATCCGACGCGTGCAATCGGTCATTGGCCTCTTGGTCAATGG
TCGGACATCTGCAGGCGACCTGCACTTGCATTCCGTGAGGAAAACAGGCCGTTGTGACAATGCATCTCCACTGTCCTCCACGATGACGGCAAGACACGCC
GCTCATAATTTGCAGTCGATATTTAGGTCTTTGGGTACTCCACGCTGCCGACTTCCTACGCCGTCGTGAACCCGTACGTCTCGGTGTTGAGCGTAGCGTG
TAGCACCTCCTTGAGCTCCGCTCGCGATGATGCCAACGGCACGTCCAACCGGTTGAAGCACGCGTGGCTTCGAATGTAAGGGGAGTGCACGCCCTTCAAC
GTGAACGGGCAGATCTGACCGTCGTGGCTCGTCAGGTGTCGGAAGCCACCGATCGGGACTCGCGAGCACCCCGTTGCAAACTGCAGCAGGCGACGCCGGC
ACTCCAGGTTCATGTCCCGCACCAGCTCCCAGAACCACCGAAGCACTCGCGTCCCCGTCAAGTTCTTGGAGCACCTCGTGTGTGCCTCCCAGTCCGTAAC
GTCGATGGAGTCGCAACCGCATAGCACATAGTCGAACTCTTCCACGTCAAAGAGCATGAGGATCTGCCGCGGAATCACTTGGTACAAGCCTTTCAAAAAC
ACGTACAGCTGGCTTGAAACGCTTTCTAGAAAATGGTAGTGGAGCCACCATTCTGCGAATTCGTGCTTGTTTTCATCGGTCACCGGGATCTCGCCACCGT
TTGACACCAAATCCACCGTCACCATGGTTCCACTTGCATCTCTGCGCGTTGTCGTGAAATCTAGTCCGAGCGTCGCGGCACCATCGTGTTCCAACATCCA
CAGAAGACTTTTGTACGTCACCGGATCCAAATCCCCGTAGTCGCGAAAAGTGAACGGAATACCGAGAATGAGCTTCAATAGCGCCGGTGCAAAGTGGAAG
CCCACCACTTCGCCCTCTAATAGCGCACGGCCAACAAGACGTCCAACTGCGAAAAAGTACGCTAGATGCTCCTCACCGATCGCCTGCCTCGAATTTACGT
TGAAGAAATACGTCTGGGCCGCATGGTTCGTGCAGGTGAAAACCCCCAGAGACGGGTCAATAACCAGCTCCGTCACGAGCGCGAACCATTCGCGGTGCAC
CCCCCAGCATCTACAGCAGTCTCTGCAGCAAAATCAATTCGCACCACCGAATGGGTATCATTGTCATCCATACAGCACAAGTACTCCATGGACTCCTCGA
CAACGTGTTCACGACGTAGAAACAGCTTCAGCACTTCCAGTTGAGGTGGGACAATCAGCGTAGAAGTACAGGCCACAAAATGTGCGAACTTGGTTGGGAA
GTCTTCTCTTGACAAATTGAGCAGGCCCTTGACGTCGACATTTCTGGACGAAGGTGGCCCCGTCGCGAATGCTAGTGCGTCGGCTTCGTCGGCAGCCACA
GTCTGTATTTTCATCAGCTTCGTTTCGTGTTCCAGCTTCCTAGTTACTGAACCAGGCTCTCCGTCCGGTATCACGTCCACCTCAGTCTCCATCTCTCTGC
CATCTTTGCCACCCCCTTCCTTGAACACAGCAACATATCCAGGATACTGGGAGCAGTTTTGAGACGCCTCCGCATTCCGATACCAACAGGCCTTTCCGGT
GCAGTCAAGCTTGCGTTGCCATTCTGTTCGACGCCTAGCACACATCACCATATAATAAAATAAGAAGTCAGCCTGCGGATCAAAGCATACACAACAAAAG
ACCAACCAACAACGCACTTTGCCCGCACTTGTCGAGCGGTAAGAGGGCTTCTTGCCCGAGATCTCTCTGTCGGTGACAGCTTGAGCTTCTCCCCGCAAAG
CACGCAGAACCTGAACCTCTGTGTGTTTGCGAATGCACACACTATGCATCGTACTGCCTCCTCCTCTGCGTCCCTGCAAGCAACCGCCACCCCGTCTCAG
TCAGCAGCGTGTCCTCAACACCCCAACCGACCTCCGTCAGCCCCCCATATCCTACGTACAACGTTGCAACATCAATGCGATGCTCTCCGGTCGCATCATC
TCTGCAGAAGCCACATTATCACAGCGTCAACACCTCAAAATATAAAAAATAAAAAAACAACAACAACGAGGAATCCGCCGCCTACCTGGCGATCAATGCC
TGCTGCAACTCGCTGTAGCTGCGCTCGCGGTACTTGCGCTGCAGTTTGCGGAAGATGTAGGCGACGATAAGGTATAGTGCCACCTGGGAGGCCACGATGA
GCACCACGATCACGTCCGCCATCTTCGGAGCTTTTCGCCTTCTTCAAATTGAGCACAATCATTGATGTCGATGATAGTCATTAATTCGAGGGGAACTCAA
CATCGATAGAGTCACTGAAGTGGTGCATACAACTATATCATGAGCGGCGCACTGAACGACAAGAGCGCGCTGGTGCTGGAGCTGGGGGCACGTTACGCGC
GATGCGGCATCTCTGGGGAGCGCGCGCCTCGCTGTATCGTGCGCTGGCAGGTGCGTTGTCACCGTATTGCGCGCATCGGGTTCGAGGTTGCTC