Description :
From Genome Similarity Track
Location :
contig_47:334494- 350540
Transcript NameFunction/comments
g9704.t1ETM02862.1 hypothetical protein L917_00770 [Phytophthora parasitica
g9705.t1hypothetical protein
g9706.t1ETO85362.1 hypothetical protein F444_00883 [Phytophthora parasitica P1976
g9707.t1XP_009523414.1 hypothetical protein PHYSODRAFT_313245 [Phytophthora sojae
g9708.t1hypothetical protein

Sequence
16046 bases(100 bases per row)
TTACAATAGGATTGCTATTGGGGGGTTCGATTATCCCCACCATCAGCTCGTAGATACACGTTAGTCGGCATGCAGCGGCGCTGGACGACGCCGAGCTGGG
GTTATGCCGTCGTGAAGCCCGTGAGGTCCGTGTCCAGCGTCGCGTACAGCATACTCTTCAACTCCTTCTTGCTGTGGTACAGCGGCAGATCCAGACGATT
GAAGCATGCGTGACTCGAGATGTACTGCGTCGAGCGGTAGGGCACACCCTTGAGGTTGAACGGGCACAGGCGACCATCGTAGCTGGTAAGACCCCGGAAA
CCCGACAGAGGGACACAGGCAGATCCTGTCGCGAACAGCAGCAGGCGTCGACGGTACTCGTTCGGCATTTGGCGAACAATCTCCCAGAACCAGCGAGTTA
CGCTGACGCCCTCAAGGTTAGGAGACAATACGGTGTGAGTCTCCCAGTCCGTTACGTCCACTTCGGGGGATCCACACAGCAAGTAGTCGAATTCTTCTGG
GTCAAAAATCAAAAGCATCTCGCGAGGAATAACCTCGTACAGACCCTTCAGGAATGCATGCAGTTGGTCCGCCACACTCTCGAAGAGCACGTAGCGGAAA
CGCCGGTCCAGGTACTCGCGCTTGTTGGCATCCGTGACAGCAATATCCCGTCCATTGGGGATAAGATCCACCACGATTTTCTCGGTTTCGTTTACCTGCT
CGGTTAGACTAAAGTCAAGTCCGAGGTCGTCCACGCCGTCGTTGTCCATCAGCCATCGGAGACTGCGGTACGCCTCTGGGTCGAGATACTCCATGTCGGC
AAACGTCACTGGCATACCCAAGATCACCTTCAGCAACGGCAGTGCGAGATGAAAGCCCCAGATGCCGCCTTCCAGCAGAGCCCGACCAATCAGTCGACCT
GTGGCAAAATAGTAAGCTAGGTGGTCCTCGCCTACCTCAGACCGGGATTGCGGATTGAGAAAGTAGCTCTGGTCGGCCTTGTTGGTGCATGTAAAGAGTC
GAAGCGTCGGCGAAGCCAGCAGCTCGTTCACCAGCATAAACCATTCGCGGTGCACCCCGCCAGCATCCACGCCGCTTTCATCCAGGAAATTGATGCGCAT
GAAGGAGCGCAAGTTCTTCGGCTGAATGCAGTACATGTGGTCCATCGACTCTTCCAGCATGTACTCGCGGTGGACAGACAACTTCAAAAACTCCACTTCT
GCAGGCACGATCAGCGAGGCCGTGCTGACCACAAAGTGCGCGTACTTTGAAGGAAAGTCGCTAGTCGCCAAAGAAACAACCTCCTTGCGTCGCTCAGCCC
CAGCATCGGCGAGCGTCGACTTCCCGGTCGCGAAGTCAGCCGGGTCCGAGACGCTCGCCTCCACCAGCTCCAGCTCCACGTCCGTCGGCAGCATGGGCTT
GTCGTCTGCATTTTCCTTCTCACTCTGCGGTTGCTCCACAGCCAGACTCGGCACTGGCTCCGTCTCCGTCATGGTTTCCTGTTCCTCCTGCTCTTTAGTC
CTCTCCTGCTCTTGCTCTTCGGCCAGTTCCTGCTGTTCCACTTCCTCCGGGAGCTTGAAACTCAGTGTATACCCCGGCAAGAGTGTGTCCACGTCGCTGT
TCGCAGGCACGTGGCCTCCGCCTCCACTGCGGTACCAGAAGAGATTCCCTTCCACGTCCAATTTCCTCGTCCACTCTCGTCGGCTGCGCGCACGCCGCTG
CTGGCGACTCAGCGACGACATTTTCCTCGGACGTGGCGACAGCAGGTGGGTCGCGCTCATGGCCATGTTGATGGCTCCTCCTCTGCTGCTGCAAGTGTCC
TCCGGCTTGAGCTGCTCGTCGTCGCTCTCGTCGTCGGCCGTGGCGAAGGACAGCGACGGCAGCTTGTCGCCGCACAGCACGCAGTACTCGAAGCGCTTGA
AGTTCTCGAACGCGCAGCTGGCGCACACGCTGTAGCCCGCCTCGGCTTCTCGCGTGGCAGCGTCGATTCGGTGGTCGACCGACTCGCCCGACAGCAGCGG
CACCTCCATGTCCAGCAGGTGGCGGTTGCGACGACACGCCATGAGCCACACCACGAAGAAGATGATGCACAGCAGCAGCATGCCCACGCCCTGGTACAGC
ATCGACGCCTCCGTGGACCGCTCGTTGTCCATCGCGGCGAGTCTTCAAGTGCTGCGGTTCAAGTCAGTCACACGCAGAATGACCTTCGCTGAGGGATCCG
TATTTTTCACTTGGTTTCAGTATTGCTAAGTCGCGTTTATGCACACTAGATTACGGCGACGAATCCCCTCGAAATAGTGACAATCCACTCACAGCGACAT
GTTGACGGGGCTTGCATGTTCCGTCACCGGTTTCCCCTAACGGCAATGTACCAACGTTGGTGCGCACCCGATGGCTCTGCTTCAAACCATGCGGTCAAGT
CACTGGCTGCCGTTGTTCCTGCCAGCACTTGTGACGTCTGGATCGGCGATCCGACGCGTGCAATCGGTCATTGGCCTCTTGGTCAATGGTCGGACATCTG
CAGGCGACCTGCACTTGCATTCCGTGAGGAAAACAGGCCGTTGTGACAATGCATCTCCACTGTCCTCCACGATGACGGCAAGACACGCCGCTCATAATTT
GCAGTCGATATTTAGGTCTTTGGATACTCCACGCTGCCGACTTCCTACGCCGTCGTGAACCCGTACGTCTCGGTGTTGAGCGTAGCGTGTAGCACCTCCT
TGAGCTCCGCTCGCGATGATGCCAACGGCACGTCCAACCGGTTGAAGCATGCGTGGCTTCGAATGTAAGGGGAGTGCACGCCCTTCAACGTGAACGGGCA
GATCTGACCGTCGTGGCTCGTCAGGTGTCGGAAGCCACCGATCGGGACTCGCGAGCACCCCGTTGCAAACTGCAGCAGGCGACGCCGGCACTCCAGGTTC
ATGTCCCGCACCAGCTCCCAGAACCACCGAAGCACTCGCGTCCCCGTCAAGTTCTTGGAGCACCTCGTGTGTGCCTCCCAGTCCGTAACGTCGATGGAGT
CGCAACCGCATAGCACATAGTCGAACTCTTCCACGTCAAAGAGCATGAGGATCTGCCGCGGAATCACTTGGTACAAGCCTTTCAAAAACACGTACAGCTG
GCTTGAAACGCTTTCTAGAAAATGGTAGTGGAGCCACCATTCTGCGAATTCGTGCTTGTTTTCATCGGTCACCGGGATCTCGCCACCGTTTGACACCAAA
TCCACCGTCACCATGGTTCCACTTGCATCTCTGCGCGTTGTCGTGAAATCTAGTCCGAGCGTCGCGGCACCATCGTGTTCCAACATCCACAGAAGACTTT
TGTACGTCACCGGATCCAAATCCCCGTAGTCGCGAAAAGTGAACGGAATACCGAGAATGAGCTTCAATAGCGCTGGTGCAAAGTGGAAGCCCACCACTTC
GCCCTCTAATAGCGCACGGCCAACAAGACGTCCAACTGCGAAAAAGTACGCTAGATGCTCCTCACCGATCGCCTGCCTCGAATTTACGTTGAAGAAATAC
GTCTGGGCCGCATGGTTCGTGCAGGTGAAAACCCCCAGAGACGGGTCAATAACCAGCTCCGTCACGAGCGCGAACCATTCGCGGTGCACCCCCCAGCATC
TACAGCAGTCTCTGCAGCAAAATCAATTCGCACCACCGAATGGGTATCATTGTCATCCATACAGCACAAGTACTCCATGGACTCCTCGACAACGTGTTCA
CGACGTAGAAACAGCTTCAGCACTTCCAGTTGAGGTGGGACAATCAGCGTAGAAGTACAGGCCACAAAATGTGCGAACTTGGTTGGGAAGTCTTCTCTTG
ACAAATTGAGCAGGCCCTTGACGTCGACATTTCTGGACGAAGGTGGCCCCGTCGCGAATGCTAGTGCGTCGGCTTCGTCGGCAGCCACAGTCTGTATTTT
CATCAGCTTCGTTTCGTGTTCCAGCTTCCTAGTTACTGAACCAGGCTCTCCGTCCGGTATCACGTCCACCTCAGTCTCCATCTCTCTGCCATCTTTGCCA
CCCCCTTCCTTGAACACAGCAACATATCCAGGATACTGGGAGCAGTTTTGAGACGCCTCCGCATTCCGATACCAACAGGCCTTTCCGGTGCAGTCAAGCT
TGCGTTGCCATTCTGTTCGACGCCTAGCACACATCACCATATAATAAAATAAGAAGTCAGCCTGCGGATCAAAGCATACACAACAAAAGACCAACCAACA
ACGCACTTTGCCCGCACTTGTCGAGCGGTAAGAGGGCTTCTTGCCCGAGATCTCTCTGTCGGTGACAGCTTGAGCTTCTCCCCGCAAAGCACGCAGAACC
TGAACCTCTGTGTGTTTGCGAATGCACACACTATGCATCGTACTGCCTCCTCCTCTGCGTCCCTGCAAGCAACCGCCACCCCGTCTCAGTCAGCAGCGTG
TCCTCAACACCCCAACCGACCTCCGTCAGCCCCCCATATCCTACGTACAACGTTGCAACATCAATGCGATGCTCTCCGGTCGCATCATCTCTGCAGAAGC
CACATTATCACAGCGTCAACACCTCAAAATATAAAAAATAAAAAAACAACAACAACGAGGAATCCGCCGCCTACCTGGCGATCAATGCCTGCTGCAACTC
GCTGTAGCTGCGCTCGCGGTACTTGCGCTGCAGTTTGCGGAAGATGTAGGCGACGATAAGGTATAGTGCCACCTGGGAGGCCACGATGAGCACCACGATC
ACGTCCGCCATCTTCGGAGCTTTTCGCCTTCTTCAAATTGAGCACAATCATTGATGTCGATGATAGTCATTAATTCGAGGGGAACTCAACATCGATAGAG
TCACTGAAGTGGTGCATACAACTATATCATGAGCGGCGCACTGAACGACAAGAGCGCGCTGGTGCTGGAGCTGGGGGCACGTTACGCGCGATGCGGCATC
TCTGGGGAGCGCGCGCCTCGCTGTATCGTGCGCTGGCAGGTGCGTTGTCACCGTATTGCGCGCATCGGGTTCGAGGTTGCTCAAGGAGTATGTGGTCAGG
TGGGGGACATGCTGCAGAAGCCCTTGACCGCCGCGGACTGGCGCCAGTATCTGTATCCGGAGCTGCACACGCTGTGCTTCGAGTGAGTGGTTTGGATCTG
CATCGACTGCGTGGGTTGCGTAGCTAACAGGCTGCTGTACTGTCAGCTTGCTGTTGGTGAATCCGACGCGTCGCCGATTCGTCGTGTGTGAAGATCTGCT
GCTGCCGCGGGTATTCCGGGAGACGCTCTTGAGCATTTTATTTGATGTTCTCAAGGTGGTTATTGGATGGGAATAGAGAGTTGTGGTTTGGGGGGCTGAA
CAGGAGGGTATTGTGGTTGTGCCAGGCTTCTGCGGTGTCGTTGGTGCCGTCCATGATGGCGGTGTTGTACGGTACAGCAAACCACACAGCTTTGGTGGTA
GACTGCGGCTGGGCAGAGACGCGACTGCTGCCTGTGTTCAAGGGTATACCGCTCCCTTATCTTTACGAGAGTAAGTTTGGTTACTAGAAGCTGTGGAAGA
ATGTGGAAGTGACGCGACGTGGTGTTGCTGTGTTGAAGCTGTGCCTGCTGGAAGCCGGAACTGCTGTGAGTTGATTCAGCGAGAGCTGAATACGTCTCGC
GACCAGCCGATGGATAGCTTGAAGACCGTTGTCACGCCTGTGACTGAAGCCATTGCAGAAGGCATTCTTGAACGGGCGTGCTTCGCACAGCAAAAGGTAC
ACCAGGAGAGACTTCATATTGCCGAAGTTATATATCGCGGAGCTCATGTTTCTGCTGTTATGTGCTTCGTGGATCAGAATCCGTTGCCAAATGTGGTTGA
CGCAGAGTTTCAGACCCACGACAATGATGTGCTGCAGGTCGGTCGCAGTAGTAAAGGCTTCATTTTCACTCGTTGCAGATTCTGACGGTGTCTCACTTGG
ACCCTACTTGCGTAATAGGTTCCTGGAAGCTTGCGCACTGGAGCCGTAGAGCAGCTACTGATTGGTATGCATTCGTGGTATCGGATGGCCTGCTGCAATT
CCTAACACATCGAATTCACCTCGCAATTCGATTGTTCAGGTGACGAAAGCACGGATGGGATTTCAATTGTCGACGGCATCATCCAAGTCTTGAAGAAGGC
CCCGCTCGACGTGAGAGCAGCAATGCTGGAGAACCTGCTGCTTGTCGGAGGAACCGCTATGATTCCTGGTAAAATTACCGTTCGGGTAAAATGTTGGTAT
ATTCCTTTGCAGCCATGCTAACCTGTCTATGCTTCAGGCTTGGCGCAGCGTGTCATGGATGAAGTACGCGAGGCTCTACATCATGATAATGAGTTTGCCT
CGGCTTCGGCTGCTGTTGACCGAGCGCAGCTCGTTCAGACATACTTCCCGCGGAACATGCTTGCCTGGGTTGGCGGATCAGTATATGCTGCCACGGAGAG
CGCTCGGCTCTCGACTATTTCATCGCAAGAATACAGCAGCTCCAACGGCACCAGTATCCCTGACTGGCTCACTGTCGCTGAAGAGGGATTCTAAGTCGAA
AGTGACTTTTGCAGCGAGTATGTGCCAGTGACGGAGTACGTGCGAGGATTTGAATGGTTAGTGTATTTCCTATTGCCGAAATTGTTGAGCTATGAAGTGA
TTAACAAACCTTCGTCAGCATGTATGGCACCATGGCTTCGTAAGCGAGACGGCTTTAATGTAGCATTTTAGCCGTCCGACTTACTTACTCGTTCGCATTC
CGAGTGGCTTGCCAGTGTCGTCCCATGGTGCCTTCATGCCAAGATCAGGCATGTTTTTGAGATTGGTAGTCGCGGCTCCACTAGGCCGCTTCAACGGAGC
GACGTGATGTGGCAGTGCTGACTTGCGTGGTTGCATCTCTCTCGCCACCTTTGCGTCTGCGTCTGCCGACGATTTCACACCTTCCTCGCGTCGGTGTTCC
TCCTTGGAATCGGCTCGGAGTTGACTCTTGGTGCGTGATGTGATACAGTCGACTGCTGCGGCATCTTCCTCCTCGTCTTCGTCAACAAAATCGTTGTCGA
CCTTCCACAGACTGATGCGGCGTAGCTCTTCACAGCCACGCACTCCATTGCGATACGTCTTGAGCTGGATACCTTCCTTCTGAAGAGAGACGTCTGGGAA
ATTGGTGTCAAGTAGCGGCTGCTCTTCCTCGCCATTTTCAAGGTAGACGTAGAAAGTGTAGTCATAGTATAGCAGCACAAGCACGACGCCTCCAATGTGG
ATCTTGCTCGCAATAGCCTCCACATCCTATGCAGATCAAGCCCAGCAACGTTGAGTGAGTCGTGCAGTTAATGAAGCATGACACTACCAAAGTGAACTGA
CCTGGAATGCAGCGCATTTGCCCATGGCAATTTCAAAGAAGCACTCAACATTATCATCCTCAAGCCAGCTTCCAACGTTGCCCGGGCTCTTGACGAACGA
CCCCCCAGTTTGAGCCAGTGTTTGCACGAATTGCTCTGCCTTGGACATCTCTTCCTGCATGGCAGGCACAATTCCTGCCAAGTGTTCCATCGACGGGGTA
AATAATGATGTCGCTGGCATCTTGGAGACTTCGCACATAAAGGTCTACGAAAAGCAAAATTGACACACGATGAGTAACACCGCGAGCAGAATGAAACTTG
ACCACTCGAACATTACCAGAGCACTTTGCTGTCGTCGAAGCATGGGGATGATGATAGGAATGTCTGACAACTCAAGCTTTGGTCCCAGATCCACGTGCCC
GTTGTAGCACCAGTTGCCAAATCGGAAGAGCACCTCGCGCAAACTCGGGGTGTTTGTGGAGCCTTCAGCACGAGGGGTGCGCCGAATGAGGAAGGTCTGG
TTGTAACCTGTGCCACTGACATCTTTGCATTGCACTTTCAGTGGCTTCGGTGGGCTTTTGTGTTTTCCGATACTAGCCGCCTGCCACAGCGTGAGCTTTT
TCATGTTGCTGCAGTCGTCCTCACGGTATGTCTGCAAGTGGATGCCCTGAAGGTGAGCCGAGAGGTCCGGGAAACGCACATCGAGCAGAGGCTGCTCGCC
GTCTGCTTCCTGCAGCACGACGTAGAAACTACGTTGGTAGTAGATTACCAAGAGCACCAACCCACGCACAAAGGTCTTGCTGGCCACGATGTCCACATCA
TCGAAGCATTCATAGCCACCGCTCTGCAACTCGAAAAAGGTCCTCGATCCACCATCGTCCAAATCGCCGTCCACCCACGTGTGCTCCTCTGCAGCTTTCA
TCAGCTTGCGTTCAATACGCTCGCTTGAAAGCTCAGCGCCGATGAAGTCGTAGACATCGTACAGCGTTTCAAGAGGTGTCGAGTATTGAGACGTTGAGGG
CATGGCCTTCCACTCGCAAATATATTGTAGCGAAGCTTGCTGCTTCTGTAGGGCAGGTACGACCACCGGCAGATCGGCGAGCTCCAGGTCGGCACTACCG
AGATCGACCTTCCCGCTGTAGCACCAATTGCCACAACGGAAGAGAACTTCATGAAGGTTGTTCTTGCTGGACCGGACGATGTACGTCTGGTTGTATCCGT
CACGCAGTGCCACAATCTCCGGGGTCGGGGCTCCCGAGTCGTCCGCGTTGATATCGGCTTCGTCGGCCTGCGCCTTGGACAAAGGCTTGTGCATGGCCTG
GGTTCGGTCGGCGTTGTCCTTGGCCTCCATCGTTGCGGCCTTCGCTGGTTCCCTAACTGAGCGAGAATGGAGGGACGCCAAGATCTTCGGTTGCGAAACT
ATCGTGGTCTCTAAAATGGGACGCACTTGCTGCATGTCAACTCGGAGCATGGCTCGAAACGAATGCAAAGTTTTGTTGTCGCATGTACGGATGATTATCT
ACACGGTGAAGCTAAGCTGCAGTGCGCAGTCTGACTAGTATGTGCAATTGGCTGACGCTCTTTCAGTTGTGGCAAAGCTACCACTTGTGCTGCTGGGCCC
ACGCACCGGTCACCTTCGGGCCCGCAGGTGCAGCAGCACTAGGTGCCGAGGGGGCAGCGGGCTGGGTAAGTGGCTTAGCCCACGCGTTTCCAGTCGACTG
GGAAGACTGTGGGGCCGGAGTGGGAACACCACCGGGCGGCGGGCCCCACGCAGCGCCAGGGGGAGGAGGCGGCGCCTGGCGACGGACTTGCGGGTTTTGA
ACGCGTGCGTGGCGACCACGCATGATGGCCTGGATCTTGGTAGCTGCCTGCGCATCTGTCAACGGTAGAGCCTCCGGGAAGGCCGTGCCGATCTTCGTGT
CCTTGCCCCGGCCGAAGCTGAAGCACTTGATGTTGCACAGGTACGGGCCGAGCTGTACGTTGTTGTTCTCCTGGCCGTTCAGGTAACACATGGTGTACAG
GGCCATCTCGAACTCCGGGCTCACTCCGATCAAGCTGCAAAATGCCACCACATAGTCGTTGTTAGTCACGTTGAATGTAGAAACCTTGATTGCAGTAGCC
AAGTTTCACCTCGTGGACACGGGCTTTATCTCGTCTTCCCACTGGAACTGGAACGTGATCAATTGCTCCTTGTTGTGGGGCTCCATAAACTTGCATCCGC
GCTGCTTAGGGCGAATGTATCCCCTGTAGTCGATGCGGCCGTTGCGCTCCTCGTTGTACACCTGGAGCCAATTGTGGCAACCGCACACTTTGCCCTGCTC
GGCGAACAAATCCATTAGCAACAAGACTAAATCCACTGATCAGATAAATCATCAATCTCACATTCTTCTCCTCGCCAACGAACACGTGCTCAAAGCCCGA
CGAGTCGTTGCGCACTTCACGGCGGTACAGCCCGAACCAAATGAGCTCGAGCTTTTTCTTGAAGTCCCCCATGTCGCCCGTGAACTTCTTGTTCTTGACC
AGCCAACTGCAATTGACCGCATACAGTCAGAACTACATCTACACCCTCACCGCCATCACCGCCATACTCACGCGTGGGCATAGCGCATGGGCGCCGTCTC
AAGCACAGCGTTCAGGAACGCGTTGTTCTCCGCCAACTCCTTGGGCGTCACGCGCTCCGTCACACCTGTCTGTGTATCACAAGGAGCCAATTACCACATA
ACTCCAGTCACGACTCCACTCTGTTCATTGCACTCTCCAAACTGGTCGCACCTCGCGCTCGTAGTTGTCCAGCAGGTCGAAGAGCAGCTTGTACGTGCGG
CGCTCGAAAACGCTCGGGTCCACGAACGTGAAGAGCGGCTCGCGCGCCGCGTCACCGCGGGCGTAGGAGGTCTTGCCCTCCTGTAGGTTCACTTCGTAGT
GCACGTTGGGCTCCAGACGGTTGGTGTCCAGCTCCCAGAGCTTGTTGCACGCGGCCGAGAGGCTCTTGAGCTCGGCGACTGCAACGGCACAAGTCAGCAT
TATATAGGATTTCTCAGCCAATTCATTGCAATTCGCCTACAGTCGGAGTGGCGTTGGCCATGATGCAGGGGCTAGCGACTATCAGCGGCTCGAGGCGATC
GGGGAATGAATTGCATCCGTCCTGCAGCTGGATCGAGCGCACCCACACGCTGTCGTCAGTTGCTGGAACGAATGATACATGTACACACGACTGCAACCAG
CGAATCAGCGTCGATAAAACAGCTGCTGCCACAAGACAAGAAATATGCCAGCCAATCAGTGTCGTCACAACGACAGCTGTATATACTTGTGTACCCGCAA
GATACTCGCCAAGATACCTTTTGCTTTCATGCCTTGCTCGTTGCTGAGCCCAGTTTTCCTCGGCAGACTAAGAGCAGGTCTCAGACTCACGCACTCTTAT
CTGCAGCATCCAAATTGTTAATTGGCAAGCTGAGTGTCTTGGTTGTTCCGCTCAACGCGAGCTATCTCACCGTGAAGCGGGACGTGCAGCTCAAACTCAA
AACTCAAACACGGCATCGCAGATACCACGCCTCGATATAATCGGTAATCGGTGGCATGCAGGCGACAACACGGCCCTGGTTTGACTATCAAGCAATGCAT
GAGATTCGACCCCGCCTCCACAGTAACGCACTGAGGATACACGTGGAGCGATGGAATTAGCCGCCGATGCGATCGCGCAGCGATTGACACGGGAGCGTCT
AAGGCATCCCGTTTAACAAGCCGCTAGCGGCAATGACTTGTGCTTGCAGCAATATCTACAAGAAAGCCTTGTACATGCTCGACTTATAAGTGATGGCGCG
CAGCGTTGCCTTGCAAAGCACGCCTGATGGCTCGAGAAGCACTGAGGGCCACGAGCAAAATGCCGAGCGCACCAGAAACGGATGTCCGTACCTTTGTAAC
GAAGGCTTCAACACTCTCTTGTCCGATAACCTGGCCTCCAGAATCTTCAGTTTGGCTGCATCCGAGCCAGACACACTCATCTTACATCATTTAACTTCGC
TCTTTCATCATTTTCAGCATCGTTGGTGGTTTTGCTAGGCCAGCCTCGATGATGTGCTTGGCCTTGCTTGGCGCCGCTCACCCGCCACTCTCGCACTCGC
CTCGCCGCGCCCAGAGCTCCGTCGTCTCCTGCCTCGCCCCAGCAGCTCCATGTGGCTCCGTCCCGGCGTCCTGCACACGCGCAGACTGCTCTTCTCGTCC
GCGTGCGGTCGCTCGCGCTCGTCTCTGGGCAGTCTGCGCGTCTTCACATCCGCCCGGGGGGCGTTGCAGGCTGCCGCAGCGCCGACTGCCCCCGTCTCGG
AGCCCCTGAGCGGCGGGTACCCCACGACCGCAGGTATGAAGCCGCCCGTGGACGACCAGCACGCCGTCATCGCCGACTTCATGCCCATCGTGCCGCCCGA
GTGTCTGCGCGTGCAGCAGGCCGAGCAGACGGCGCGTGGCGCCACCGTGGGCCCGTCCTCCTTCACGTCCATGTTCCGCGACATGTCGCCCTACATCAAC
TTCCACCGGGGCACGACCATGGTCATCCACCTGCCCGGCCAACTGGTCGAGTCCAACCTCTTCGGCGCCGTGATGCACGACATCGCGCTGCTCAACACCT
TTGGCATCAAGTTGGTGCTGGTGGCGGGCTCGCGGCCGCAGCTGAACAGGCAGTTGTCGCTTCGCAAGCTTTCGCAGAGATTCGACTGCGGCATGCGCAT
TACGGGACCCATGGAGCTTCAGTGTGCCATGGACGCAGCCGGCTCCGTGCGCTTCCAGATCGAGAGCTACTTGGGACGAGGAATTGTCAACTCGCCCGGA
CGAGCGAGGACGATCAATATTTCTTCCGGGAACTTCATCACTGCGCAGCCTGTTGGCGTTCGAGGAGGTGTCGACTTCAAGAACACAGGAGAGATGCGAC
GACTGAACGTCGATAAGGTGCGCACTGCACTGGATGGCGGAGACATTGTGCTCATCTCCAGCATCGGCTACAGTGCCAGTGGTGAGGTTTTCAACTGCCT
CTCAGAGCAGGTGGCGAGCAAGTGTGCCATCCAGCTCGAAAGTGCCAAGCTTATCTTCATGCATAACGGCGAGGAGCTCATCGACTCGCGATCCAACTCC
ATGGTGCAGACTCTTGTGATTGAACAAGCGCAGCAGTATGTCGAGTTGGCGCGCCAGAACACGGACATTAGCGGCGATTTCCTGCTGTACTTAAAGGAGT
CTATCAAGGCCTGTGTGAACGGAGTCAAGCGCTCACATCTTGTCAGCCGACACGTGGACGGCGGCTTGCTGCAGGAGCTCTTCACCCGCGACGGCGAAGG
TCTTATGATTACAAAGCACATGTACGAAGGCATTCGGATGGCCTCTACCAACGACATTGTGAGCGTCATGCGCCTCATCCAGCCTTTGCTGGACGACGAC
GTGCTGGTGTCGCGTGATCAGGAGCAGATTGAGAGCAACGTGGACACGTTCACGGTTGTGGAGCGCGACGGTGCGATCATCGCTTGCTGCACACTGCAGC
CGTACGAGAACAACTTCGCCGAGATGGATGCGTAGCCGTCGACCCGACCTACCGCAACCTCGGCAAGGGCAATGCTTTGCTAGGATATATTATGCGCAAG
GCAGCAGCCATGGGCGTCACCAAGCTGTTCGTGATGACGACCCGAACAGCCCACTGGTTCCTGGAGCGCGGCTTCGTGGAGGCTACAGTGAACGATCTGC
CTCCGTCGAAGCTGGCCAAGATCGACCTCAAGCGCAAGTCGAAGGTCTACATTTGCGACATCAGCACGAAGAAAGCTCTGGACGAGAAGGAGCTGCTGCT
TCAGATGGAATAACTCGGTGCGCTGCCAATTTTACGCTCGACCGACTTTTTGCCTATCGGTCGGCACCGCGATTCCTTAGAGCGGATGCAGGAAAGCGAG
CAAGCCAGTCATATTTAACTCACAGAAAGCTGCTCGGACATTTTCCCTCCCAGTCGTTCCCATGACTTCCATCTATCTGTTGACTGACGCTACTTGGCAA
GGCCGTCTCGCGTTTGGCAGGCATAGCCTGTGTAGCCTTGAAAGCAGGTGCAGGTTCCCGCCTTGTAGTTACACACACCGCGGTTGGAGCATTCTACGAG
GCACTTATTCCCTGCAGCGCCAACGGCAGTGCCGCCAGGAACAGTCTTTCCCTGGCAGTTGGTTTCGTCTACAGTTGTGTCCGGGTCGTCTCCGATGGGG
CAGTGTCCTGTTGAAGTTGACACCAAGTTGAAGTCAAGCTGAAAGTCAGATGAGTGCAGGTCTTTGAGCAATCGTACGTTTCGAGCAGTCCGCGCTGAAA
TACTCCGTGGCTTGCAGCTCGCCGCTCGCCGCCCCGACAGCCCAACCAGAGTCGCAGACACACCCAAAAATCCTATCGGCGTCCCAGGTCGCGGAGAACT
GCAGGCGACAGACAAAATGGTCAAGGTCGTGCTCCAGATAGCAAGTTTTGCTAACGGACGTACCGGTTGGCCTCCATAGGTTGTTGCCGCAGAAATGGGC
AGTGCGTTTTTGGCGGCGGCCATTTCGCGCATACTCATGCAAGTGCCTCGGTCTGAGCAATCGTTTGGGCAGCCCACTACATGCACACAGCAACAGGCGA
CAGTGGCGGTGAGCAAAATCGAAGTCTCACAACAACGAAACACGTACTTCTCTCGCATGCGGAGCCTTCAATGCCAGGAAAGCACATGCAGGTCCCAGTG
CTTCGGTCGCAGATTCCCATGCCTGAGCATTCTACTAGGATGTCATGGGCAGTGACAGTGTCCGTGGGAATGGAGCTCCACGCGTAGTTCGATGGGCATA
CACCTGCATACATGGACGCCAGGTTAAAATGTCGACCTCGTCGGCACGAATCTGCTTCACATACTTACGCGTAGAGCAGTCTGGTGATTTGTAGTCTGCA
ACGTCCGTCGGCGCACCCCATCCAGTGCCACAAATGCACACTTTTGATAGCAGCGTGCAAGTACCATGACCACTGCAGTCGTTTACGTACGTGCAACCTT
CACCACCGATGGTGCTGCTCTCTTCGATGGTATTGCCGCCCGCATCTCGAGTGCGCACAACAAAGTTCCCAACGGCCGAGTTAGGAGGTGTGGTGATCTG
GTCGACTGTAAATGAGAGACCAGTGCTGGGCAAGATATTCGTGCCTGCAATCTTCAGTTTCACTGAGCTCGATGTCGCAGTGAGCACGGAGCTGGCAATC
GGAATCCCAACCAACGAGCCTGCGACGAGCGTGGCAGCCCCGACACTGTAGCCATCAGGAAGCACAGCCTCAATGTAGCCGCCAAGAGGGATGGTCGCGA
CGGTGTCTACTGCCACAGTCGCTACTGTGAGTGTATCGGGGGACCTGAGTAGCGGACGCACGCGGCCGTAAGTAAGCGGCTTCTTGACGATTGGTGTACC
GGGTATTGTCGTTAACTGCTCGAACAAGTTGCCCCCACTGTCGGTGATAGTCACAGTGTACGTCTCCCACGTCATCGCGCAGTATTCCACGATGAATTGG
TCGCACGAAGTTCCGGGATTCGTAATGCCCTCCACAGTAAATCCGCGGCCAGTTCCTGGGACTACAGCAGTGTTTCCTGTTATCATTCGTGTCTTGGTTG
AACTCACCGACCCGAAAACAGTGTTCACTGTGGGTAGGTTCGTGGTATGACTGAAAGTTACGGCGCTAACGTCGTACCGGGCCGGAAACGTAACATCAAC
TCGACTACCTGACGGCAAGTAGGCCGAGTTGGCAAACGCAACAGTGTAATCCGTGACAATACCGGCCCAGTAAGATATGGGTGTCACCGTCGCCGATGGA
AGCGTTGCGCTCGTGTAGGTGAGCCCAGCCACTGCCTGGTTTTCCTGGAATATGGCCCCGGTAGGGTGCCGTGTGTGAACTCCAAAAACTCCCGAGGCTT
GAGCCGCCGGATTGATAATATTGCCATACGTGATCGACACGCTCGTTCCGGCAGCAACGTCTTGGCCAGCAATTGTAAGGCGGATATAAGGCGAAGCCAC
TTGCACTATCGTCGAGGCTACAGCAATGCCTCCCAGACTGGACAGTGTCGCGCCCGTGAAGACAATTGTGCTGGCACTGAGAAGCGGGAACTGCAGTGCA
ATCACGCTCCCAACGCGTAGTGTGATGCTCGTCGTGAAGGAGATACTGTACGCTGTCGTCGTGCCGGCTACCAGTGATGCCGCTGTCACTACCGGGCTGG
AAATCGTTCCTAGAGTGATCATCGATCCCGGTACAGTAGCTGACTCGAGGGTCGAACCGCTTGCACTTTGCGTGCGTATCAAATACGTGGAGGTTGTGCC
CGAGCCTGTAGTGCCTGTAGCCAAGTTGGTTTTACATCCTATTAGTCTTCGCAGCTCAAAAACCTCCGTGTGTCATTCGTTTTACCTGGATTCGAGATAC
CGTCGAGAGTGAAGGCGATCGGTCCAGCAGTAGCGTCCGTACCGGCCACCGCGATCGTGACTTGTGCGCTGGCAGGTGTTGCTACCATTGAACTGCTCAA
GTCCAATCCCGAGGTGATCGTGAGCGTCGTGGAGGCTACGTAGAAAGTGGAGGGGAACATGACCGTGATCGTTCCGCCGACAGGGACGGTAGTGCCTGTC
GTAAAGGCCACGCCCACATTACCCGTGACGCCAGCGACAAGAGACGCAGGTGTGATGGTCGCAGGCGCGATGGCTGCATATCCTCGCTCTGCGCATGACA
GCCACAGCAGCAATTGCAGCCACCACATCGCATCCACCCTTTCAAG