Description :
From Genome Similarity Track
Location :
contig_8:33448- 34653
Transcript NameFunction/comments
g1925.t1hypothetical protein

Sequence
1205 bases(100 bases per row)
ATTCCTCACGGTCAGATCCGAGTGGAAATGGCACTGGTGTACAGCTTACTCTGGGGGTTCGCAGCGTCTACGGGGGGTCAGAGAGCCATTCAAGGGCAGC
TTAGCGATATGGTTCGACGCGAGTTTGACCACCTCACTCCTGCTTGGGTAACTTGCGGCTCGGACGTGAACTTGATGGAGACGCTGTTAGATCTCCAAGA
GCTGCGCTTTGTTCCCGTCGTGAGTGCGTCAGGACAACCAACAATTCCTCCCCAAGTGGCGACTAGCAGTGGTCACAGCAGCATCAGCACTTTGTTCGTT
CCTACCGTGTCAAGTCTCGTGGCTCACGCCGCAATCAAAGAAGCGCTTCGCTCGGGGAGAGGCGTATTGCTTCTCGGTGGTGATAGCACACGACGGACGA
CTCTCGCACGATATTTCCTCAGCCAACTTGATGTTCTCCGCGCTGTTGAATCGGCAGGTGGCGTCTCCAACATGCTGCGAGCTCAAAACGGGGACGACGA
TGGCGACAATGCTCGAAAGCCTGACGTAAAGTCGAATGAGGCTGCAACACTCGCGTCTGTGAAGCGCATTCGCCTGCGTCAAATCACACTGGTAACGCGG
ATGGCTCTGCGACTTCAGAAGGACTCGAACAGGGCGGAAGTTAGTCTTCAACCGTCTAGAGATGCTTCCGTCGCCAGTATCGCCACTGCCAGCGACAATG
AATCCATGGCATCCGTTGTCGAGGCTGAGGAGGGGGCCCCTTTGGCCATAACTCCATCCACAGACACCTCCAAGACAGCCATGGTACGTCAATTTGACCG
TGGCGACGTCATCCCCTTCTTCTTTGCGATGCCACAGACTGGGGCCGGAGATGTGGCCACAGAGCTCGCAAACTGCTTGGAACGGATGCTCCAACGTGAA
CGTACTGGTGTTTTCGAGCCACCTCCTGGCAAGACGGCTCTGCTCATCTTGGACGACTTGCACCTTGCAGTTCCACAAGAAGATGCTGCAAACCAAGCTC
GCAACTTCCGCTGTCCCCGTCCGTCTACGCGTATCTCCGCTACGTGCACGAACGCGGGGTAGTCTATCGCGGTACGAGTTGCTTGCCTACCTCGGTTGAG
AACCTGATGCTTTTCACTACGATGCGCAGTGAGCATTTCCCAACTACTTCGCGTGAAGCAGCTTGTTCCGTCCGAGAAGAACCCCAACGTAAGCTTACGT
CCAAG