Description :
From Genome Similarity Track
Location :
Scaffold_105:33447- 35244
Transcript NameFunction/comments
Phymu_g4418phospholipase D-like protein

Sequence
1797 bases(100 bases per row)
CGCACTATGATGGCCATCTCATTTATCGCCTTCCAGGCGAGAGTAATCAAAGTGGTGTCGGTGATGCTAGTCCTCATTTCGCATTTTGCCTTGTTCACCA
CACTTGCGGATCCAGCACCCCAGCACGATGTCAGCCTCACCGTTCGATGACCTGTCCAAGGGTCTAAGCCGCGCTTTCGAGTTCATCGTCGACCCCTTCc
acctcaagaagaaggcagagaAAGATGCCACCGCACCATTCGACCAGCCGTATCTCGAGCCCACCCGTTGGTTCCTAACCGAGGAAGAGATGCTAACGTC
CCGCAATGGATCCAAACGGGAAGGAATTCATCTGTACTCCAAGGGAAACCGCGTCAAGCTCTATGTTGCCTCTGCGGGGTACTTCAGCGACGTAGCCGAC
GACATGATGGCTGTGCGCGATGGAGATCTCGTGTACCTCACCGGTTGGGGAACCTGCAACGTCCCGTTCAAGCCCCACGAACCCGACACCAAGCTGTGCG
ACCTAGCCGAGGGTGCTGTAAAGCGCGGAGCCGATTGGCGCATGCTCGTGTGGTCAAACCTTACCGAACGCGCACAGAACCACGAGGTGCGCGACCTCAT
CAACGCTCTTCCGCCTCCGGAGCAGCACGGACCGGCACGTTTCGTGTACGACGACCGTCTGCCATTCCCCACCTCATCGCACCACCAGAAGTCGGTCATT
GTACGTAAGGGCCGCGAGGTGGTAGCCTACGTCGGCGGTGTCGACCTCACCAACGACCGCTGGGACACCATCGAGCACGACCAGGCTGAGCTCCGTGAAC
GCACGGGCATCAAGGCCCTCTGGAACGGCTGGCTGGATGCCCACGCTCGTATTGAAGGCCCGGCTACTAAGGACGTGGCgcagaacttcttcgaccGATG
GAACTCGGAAGACAAGCCGTCCCAGGATCTAATGGACGATCTACTGGACTTTGAGAACCCGGCCTACTCGGCACTACCCCCAATTGACGAAACACCCGTA
GACATCCCAACGGACGGCACCCACGCCGTGCAGCTGTGCCGCACTTTCAGCCCGGACTATGACCACTACGGCTTCGCGCCGCAGGGAGAGCAGTCCATCT
TCCATGCGCGTATCAAGGCCATCCGCAACGCGCAGAACTACATCTTCATCCAGGACCAGTACTTCATTCTggtgccggagctgctggaggctaTCATGGA
CATGATGCCCAGTATTGAGCGCCTCATTGTCATCATGCAGCGCACCGTTGAAGCCGAATACACCGGTTATGCCAAGTACCTGTACGACATGGTGTCACCA
ATCCAGGAAGCTTACCCGGAGAAGTTCAAGCTGTACTCGACTAAGGAGTCGAAGGAGCTGTACATCCACAGCAAACTGGtgatcgtggacgacgtgtacg
tgtcgCTGGGATCGGCCAACTGGAACCGCCGTAGTATGACGAGCGACACGGAGATCGGTGTCAACATTGTGgacacggagctggtgcagtcgcCTGACAA
CATCACGGTGAACAAGCTGGCGCGTGACTTCCGTATCCAGAAGTTCATGGAGGCGACGAAGCTAACGCACGATgagctggacgccatgacgttcctggag
gcttgcgacgcgctggaggcggcggccCACGATGACGGCAAGAGCATCATTGAGCCGTACGCAGTGGAATTTAAACCACAATTCAACCTCGTTTCGGATG
GTCTGCGTCAGCTAGTCGACCCCGATGTGGTCCCTGAAGATGACCCCTCCAAGAAGATCAAAAACTTCTTTacgaagcacaagaaggaaGAGCCGTA