Description :
From Genome Similarity Track
Location :
Scaffold_19:334458- 336521
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007620Similar to ELI3: Probable mannitol dehydrogenase (Mesembryanthemum crystallinum)

Sequence
2063 bases(100 bases per row)
TTCATCCACAATAGAAATGAAGGGGTATAGAATACATTTTCTTGACAGAACGAGTGAGGATGCTCTAATTAGATACAACGGTAGCCCATAGACCCTTCTT
GACTACTGATCTACTTTAACAGGGTACTTGAAAATATAGGAGGCTGAAAGCGGAGGATAGACGGAGCGAGTTGCCTTTTCGTGTGGATGATCCTTTTTTT
TGTTTTGTTTTTAATCATGTGTCTAAACTAAGAAGAGCATGCATGTAGATAGGCTGACTAAAAAGCTGTGAAGATCGATCTATAGCGTAACTATTCGGCT
ATCGCAATCGCAGCTTGCCGCCAAGAGGGCCGGCCACAAGGCAGCCCCTTCACCGCTCAGAATTGCAGCTCCCTCGCCATTCTGCAATTTGCTTCCTCAG
CATCAACGAAGACAGCCTCCACCAGCTCGCCAACTCATCAGACACGATGTCACCCACTAACGCTGCTGCGCCCCGCACCATCAACGCCTTGGCTGCCTTT
GAGCAAAGCGGAGAGGTCAAGCCGTGGCAGTACCAGTCGCGTCCGCTCGGCGCCGAAGACGTCGAGATCCAGATCTCGCACTGCGGCATCTGCGGCTCCG
ATATCCACACCCTGGACTGTGGCTGGGGCCCAACTGCGTTCCCTTGTGTTGTCGGACACGAGATCGTCGGCGTTGTCACTGCTGCCGGTCCCGATGTCAA
AGACCTTGCTGTTGGCGACCGCGTCGGTGTCGGTGCTCAAGCGTGGGCGTGCTTGAACAAGGACAAGGAACGACCGTGCGCTGAGTGTGCCAGTAGCGCT
GAGTCTTACTGCAGCCGAGGTGTCTGGACGTACAATGCGAAGTACGAAGATGGGGCGTCAACCTATGGTGGCTACGCCGACTACATTCGTGTGTTGGCCG
ACTGCGCGTTTAAGATTCCAGACAATATCCCGTCGGACGCTGCTGCTCCGTTGCTTTGCGCGGGTGCTACAGTCTTCTCTCCATTAAAAAAGCACAATGT
GAAGCCTGGTGATCGTGTCGGTGTGATCGGTATCGGCGGCCTTGGCCACATTGCGATTCAGTTCATCCGCGCGTTGGGTGCCACGCCCATCGCGTTCTCG
CGCTCGGCGAGCAAGGAGCAAGAGATCCGAGGCCTCGGCGCCGAGGAGTTCTACAACCTGAGCGACCCGGAGCACGCGCAGAAGGCTGTTGGATCGGTGA
ATGTGTTGCTCATCACTGCCGATGCGACCAACATGCCATACAACACGTACTTGACATTGCTGCGCACCGGAGGCACGGTCGTGATGTTGGGTGTTCCAAA
CGACAATGTGACATTCTCGCCTTTTTCACTATTGGCGAAGGGCATTAATTTCACTGGCAGCGTGATCGGGTCGATCCAAGACATCAAAGATATGCTGAAG
GTCGCTTCCGAGAAGAACGTGCGTCCGATCATCCAGAAGGTTCCGATGGCCAAGGCGAACGAGGGTATCCAAATGGTTCGCAAAGGCTCGGTCCGCTACC
GCGTGGTGCTTGAGAACTGAGGTGGTGCTCGTCTTTTGATCCGTGTGGGGGTCTGAATGAAACTTTTCTTTCCGTCGTGATGTACTTTAGCGACAGCACA
GCAACCTCTTATTTGGATAGTAAGAAGAACATTCAAAGAGTCGTCTTCAAGCAAAAGTGTGATTTTGAAAATCACATCGAACTTAGATTATGCTCCAGAA
AACCCAATTTGACAGTTAAGCTTTTGAAAAAAACAGGTTGACCCATGAACCTGAGATAGCTCAATTATCGGCAGTTTTTTTTCTACTCTGGAGATTTCGT
GTTCGACGGGGCCAAATCGAGAAAAATATTTTTTTCCCCGAAAAGTTTGATTTTGGTGCCCCCTTGAACACGGCCTTAGTTTTTTTTGATAAACCAAACT
GCGATGTGGAAGATTGAGATGATCGGCGTCATTCTACACTGTAATGGCGCTGAAGCACTCGAAGAGAAAAGGAGACTTCTCAAAAACAGCCTCCCCGCTC
ACGAGAGTTTTTCTCGAGGGTAACGATCGTTATACTAAGACAATCATGACTCGGCGAGGCACG