Description :
From Genome Similarity Track
Location :
Scaffold_24:334456- 337653
Sequence
3197 bases(100 bases per row)
GGGGGCGGCCATTAAGAAGGATCGCAACTACCTCACAAAGCTCTGGACCCCCCCCCCCCCCCCCCCAAAGCGGTGGACAAACTGGCCAAGGACCCTGGCA
TCATGAGGCTCACGTCTGCTCTGAAGGGCGATGGCAAGACTATCGATAATAAGATCATGAAGAAAGAGATCAGGTAAAAAGAGATGGCTGAGAGTAAGAA
GAAGGGCTTATTCGCGGTGCTCCTTACAGCACTCAAGCACAACCGCAAAGCTGTGCTCGCAGCTACTGCTTTTTTCGTAACTATGTTTGTGATCATTTCA
CTTGGAAAGGCTGGGGTTATCAAATAATACACGGAGTTAGTACGGAAACTGAAGATTTTCACGAGTGGAGCAGTGAAAACAGCTTTTTAGAAGGAAGGCA
GGAAGTTGAAACCAACGCAGATGAAGACGTAGAACAGCGTTAGTTTCAGACTTCCTTTACAGCGCTCACAGCTTAACCCTCCACGCCACACCCCGGCTGT
GGAGGCGCTGCAATGTAATTTTCAACTTTTGTGCCGGGTTCGGCACGCCCCCAACAAGTAAGACGACGACGACGACTGAAAAGCTTCTTAACCGGAACAC
TTCGTAAGAAAAAAAATAGCCGTCGACCTAATGGGTACATTTTCGCCAAAAACTATTTATCTTACTCTTGGGCTTTCTATCATTTTTTCCGTGTTAGCGT
TACACGGTAAGAGAATCGTTATATGGCGGTGAGGATAATGGTTCTATTATTTGAAGAATCAAACATTTCGTATTTGAAAGAGTGTGCCGTGCCTTCATCG
ATACGGAAACTAACTTATTGCCAACAATACTTCGACATCAACGGTGGAATAAGTTAAAATTCAACCACCCGTTGCGCTGGTGTTGAAGCAAATTAAAAAA
TCGCGGGGGTGATGGAACCCGATCGCGACATTTTGATCAACGTGGCTGCTCCCGACACCTTTTGTATCATAGTTTGCTCCCACGTGTACGAATTGAGTTG
ATCGAATAGATCTGGCCCTTGCGGGCATTGTTTCACCGGCAAAACCCCTTGTACAATAAGATGCACCGTCCTCGAAATGACGACCTGACGGAAGCTGCGT
TAAACTCGCCAACCGACTGATCGCATGGTTGTGAACTTTCACTGTGAAATTGGAAGGATTACCAGGGCGAAGAGGTATTTGGGTGGTGTTGGGGAACGAC
CCACAAGAAATAATTGCCATTGGTTTTGCCCAAAAGAACGAGCCAGTCACGGAAACTAGTATGGCTATTCAGCTCATCGCCCGAGCCATGCATCAGCTAA
AGCAGCGAGCTCAACTATCTACAGTCTCTCTTGGTGTCCAAGGCATCCAACCAATGATCAAGTCGGCTCGAGCCCAGAATGCCTCGCACCAAGCGCTCAA
AGACGTTGTCTCGATCAGCTTCCAAACGCATCTACAAAGCGATCAGGGGATTTCTCAAATTGCGACAACTATCTCAGTTTACCAATGCTGTAGTCCAAAT
TCCACTAACGTGGGGAAACTTGCTTGGATTTACAACATTATCGAGCGTATCAAGCAGCGGTCGACAAACTCGTAGCGGTGGCGAATGAAAACTCAATCAA
CCCTAAACGGTTGCATTCACTTTTCGATTCGGTGGAGCTGTAAGTTTCTGACTGGTGAAGTAAGTAGCAAACAGATCCCTCCTAAACCCGTTGGCGAGAC
CAACACAGTTTTTGCAGAATTTGATCAGCTTTTGGAGGCTAGCGTCCCTGCTAATATCCAGCTTATACACTGTATCGCGTGACCGCTGGGAGACTGAACT
TTGAGCGGCAAATCCCAGACACTGCCATGCTACAAACGTGTGAGAGGGTTGGTGTCAACACATTGATTTACGATTTAGCTGCGCCAATCGGACATTGTGG
AGATGACAGCGGGATTGGCTTGGAGCGCGATTTCAGATTTATTTGTTAGCCTAGATTGCTCGACTCAGTTTACAACTCAAGCGCTTCTCAACGCGGGCGT
CTTCCTGGGCTCAGTGATCTGCGGCCGCACACTGTGCACATCAAAGATTCACGGAAACCAAGCACGACTTACATCTCGGACGGCAATCAAAGCTTTGCAA
TTGTCATGTGACAAGATACCTGACGATGTTTTTGCCGCCACTTGTTCAGCACTCAGTGAAACGCATCGGCAAACAAAATTAATACTCCTGACTGTGCGGT
CGATCAATCCCCTGAGGTGGGCGTGGCTGGTATATGCTCTCTACTACAGAGCTTGGAACGGCGTAGAAGACACTGACTTTGCTGAATCAAACTTGCGGAT
TACAAATATTAAACTGACCCGCGCAGATGTGGACTCTATAGAAGCAGCATTGGAGTATGGCTATCCAATAGAATCGCCTCAACGTGATCTTGTCTACGGG
TTCGTGGATATTCACGACGGAACTCCATTGTGGCCTCGTGGGTGTCCAGAAGCTGGTAGCAACGGCTTGATTGCATCATCTCAAGTCCGATGCCGAGCTT
GTTACGACCCAACCAACTGCGACTTCGTGGAAATCCTTGTCCCTGGTTACGGGATTTGCGAGGCGAGAACTGGAGGTGCGACCGTGTTCACACCCGTTTC
GAAGTAACCGTGCGTGACCAAAAGCGACTTTGTAAGAGCTTGGCATTGGAGTTCGACTCGATTGAAAGTGTTGGGTTGGTGATGGATTTGCTCAAAGTAG
CATTTCATTGCATTCGCAGGTTATCGATTAGTGTGGACGAGGGGCAGCTCCTCGTGGACCGGAGCGTGGTAGCTGCCGTTTGCCCAGCGCTAAAGTCTCT
GAGCACATCGTGTTGTACGATAGTTGCGTCTGCATATTACTCGGCTCTGTGTTTGTGGCCCATTAAGGACATGACAATCTGCCAGACAGCCACGGTGACA
CACCTGCTATCATTGCTGTGAAATCCAACGCTTCGAATGAGACGGGAGCTCGTGGAGTTAATAGTGACGCCGGTTCAGAACCGAAAATTTGACGCGGAGG
AGAGGAGGGGGCTCAAGGCCCATGGCGAGGAGTTTCTGCACGTCACGAAGGAGAAGTTGCCCAACCCGGCTAAATCTGCACTGATTAGTGCCGTGATGAA
AGACCACACGGGGCGTCACTCTACGATGAATTCGAGGGCAATTCGCCACCTGGACGCCAATATCCCGAGCCTGATATTCGTATTCGCGTCGACACCC