Description :
From Genome Similarity Track
Location :
Scaffold_673:3344- 7380
Sequence
4036 bases(100 bases per row)
GAGAAGTCTTGTATCGCTTGGACGCAGCTACCCGGGAGTGCCCTCGTGACAAGGAGTCAGAGCTGAGATCGGTTGTGCCGACAGACTTGCGTCCAGACAT
CCTGCACTATGCACATGAAGATGTTCAGGGCGGACACCAAGGCATAACTCGGACGTATGAAAAACTGCGTTCAGAGTTTTACTAGCCGCGGATGTACGCT
GATGTGGAAGTTTTCGTGAAGGAGTGCACTGACTGCACATCCGCCAAGGGACGACCACTGAACTCAGGACCTTCGCCCGGCAACATTGAGCCTAGTCGCC
CGTTCGAAGTGGTGTCCATGGATTTCGTCACGCACCTTCCAAAGTTTGAACGCGGAAATACCTTTTTGCTCCTGTTTCAGGATGCATTTTCAGGCTATGT
GATGTGCAAGCCGATGAGCTCGACAACTGCTCAGGACGTGGCCGAGGCGTACCAAGAGCGTGTTTTCAGACAGTTTGGTGCCAGTTCCAAGTTGCGTCAT
GACCAGGACCCAAGGTTCATGAGTGAAGTATTTTCCCGATTCAGGGATTTGCTTGGCAGCAGACAGCGGGCAACCCTAGCTTACCACCCTCAGGCAAATG
GCCAACAGGAACGGTCCGTCCAGACGGTGATTCGCAGTGTCCGAGCCTACGTCGCTGAATCTGACCAGAGCGACTGGGACGAGCACGCTGAACGACTGAT
GTTTGCGCTCAATACGTCTTTTGATGCGACCACGCTTGATACGCCGTTTTACTTGGTCCACGGTTGGGACGCTCAAGGGACGCTTTCAGCGATGCTCGGA
CCCTAGCCGTCGAGTGTGCCTGAGCGCAGCGCGTATGAGTGGCGTCGCAAGATGCAACATGATTACAGTTACGTTCAAGCCTGTGCGGAGGACCTGCAGA
AGAAAGCGAAGAAATTACGTTCAGAGGTTCAGACCCTGAAATGGCAAGAATTGTCTGACCACATCAAGGCCGGGTTCAAGGTGGGAGACGCCGTCTGGCT
CTACATACCCAAGGTTCAGCCAGGTCTGAGCAGGAAGTTGGCTCACATGTGGCATGGCCCGTTCCGGATTGAAGAGATGCACGACAATTTTAGAGTCAAG
CTCAAGGTGAAGGACACTGGTTATCGCGTGAACCCCTGGGTGCACGTGAGCTGCTTGAAACCGCGAGCACTGTTTCCCAAATGTCCGACTGAAGAGGTGG
AGGTAACTGAGAACAATGATTTCGATGCCGCCTTACTACCCGAGGACAACTGGGAGCCTGATGCTCTGAACGACGAATATGAAGTGGAGAAAATCTTGGA
TCTGCGTTGGGTCAAGCGCACTCGGGCCTCTCGACGCACTCAGGAGTACAAAGTCAAGTGGAAAGGATACGATGAACCAGTGGCTGCCAGTCACTCAGCT
GAACTGCGGTGCCCTGCTGTATGCGTTCAACCAGGGAGCTAAGGCGCGAGCCCGCTTCCAGGCCATGCAGGCTGGGGATGATCATCCAGGCGTGTAGCGC
TCGCTGAGCCCACATGCCTGACCGCAGACCGCTGAACATGTGAACGTCACTGAACCTGCCCCTGAAACTGACTGTACACTGAAAACAAGACCGAGTGACT
CTGACCGCAGACAAATGTGTGGACGCGGATTTGACTGAACGCAGATGTTGATGACGGTGAACATTACGAAGTGGAGATGTGGAGATCGGATTATGGAATT
ATTTACGCTGTGGAGAAGGCAAGTGGAGTGTGGCCAGCCCGCCATGCGTTGATGTGACTTCGGCGGAGAAGTGCCTGAACAAGAGCTGAGGGACGTGGCT
GAAACCCCGTTTCAAGCAAAGATGATTGAGCGCAGAAGATTGAAGAAGGTTGGATCAAGGTGGAGAACAGACAAGAGGGTGTGAAAACATGTATTCCTGA
ACTCTGAGTGGCTACGCTACGACATGCAAATGGAGTAATGCTAAAGCTGCGTCCAGAGTCCGGGATGAAGAAGTGCGGCTAGCGATTCACTGATCCCTCT
CGCCCGTGTCACCCTCCTCAACTTACCCCTCCTCGACTTCCTCCTCTTCGACGTCTTCTTCTTCGACGTCTTCCTCTTCCTCGTCTTCCTCGTCATCGTC
ATCGAACTCGCTCATCTCGTCGTCGTCTTCGTCATCCTCCTCCTCGGGCTCGTTGTCCAGGCGGTCAGGGACGATCCAGTTGCGAGCGCGTTGAGGGAGT
GGAATCGAGTGGTTGGCGCGGAGATCGGCTGAAACGTACTTGGTGCGTTCAACCTCGTTGGCTGCAGTCGCCCAAAGAGTGCGGGCAGGCTCACGCTCGT
CCAGCTCGACCAGCTGCTGACGCAGGGGCTTGGGCTCGCCGTCTGAATCAACGACACGAGAGTCCTCCCAGATCCAGTTGCAAATACGCTGCGGCAGCGG
CCAGATGCCAGGTTCTTGAAACAGCGTTTCAGGGAAATCCTTGATCTTGACCAATTTCTTGAGATGGGTTTTGTACCGGCGGATCTATGAGTCTGTGCGC
CTGCGGCGAAGCTTGTAGAGTCTCTGAGAAGCAGCATCGCGCTCAAAGTTGATCGTGATCCAGTGCAACAGGTCCCACCACGCTTGGCAGAACTTCTCCA
TGAACTCGACGTGCTTCTTGAGACCGCGCATGGTATCAGCGCTCAACTTGGACGCATCATGGCAGTACAGCACTTTTGTGCGTTCAGCGAACATGACGTT
CCAGGGGAGCTTTTTCTGGATCATCTTGCCCCTGGGAAGAGCGTCACGTACAGCTCCATGCTCCAGCGTTCCTCGAGAAACTTCATGTCATACTTCTGCG
GCGCGTAATTTGGGAACCCGATGGTCTGAGGCTTGCTTTTCTTCTGATAGAATCACATCTTGATCCCGGAACACATGTAAGACGTGGAAGTCGCTGGATC
GGGCGTTTCAATCACGCTCAGCTGTTCCAACGTCAGACGCTTGAACGAGATTCTAGCCAGAGCAGTAGCCTTACGTGGAGACTCCATCAGCTGCTCGATG
ACCTTGGCCGCAAGTCGCGCTTTCTTGACCGCAGATCCAGACTGGGTTGGTTTGGCCTTGGATTGATTCCGCGGCGAGCGACGAAGCAATGAACCTTCTT
TTTGGTTGGCCGCACCCGATTCAAGCATGTCGAGTTTGCGCTTGGCCGCAAGAGATGACTGCTTCGCTGGAACCACAGTTTCAGGAACCTTGGGTGCAAC
ATCCGAATCGTCAGGTTCAACATCGTCTTCTTGCTCATATTCGGAGTCCCCGCTGCTACTGGAAGAGAGCAGCTCGAGTCCATCTCGCGTCCTGGTATGT
GAAACCGTTCCGCATTACATAGCGCAAATCATGACGAAGTTTTCGCCAAACATGAGGCCCCGGGAGAACTTCTCGCGCTTCATCCTCGGAACGAGCGAGC
TTGGACGACGCTGGAAGAGCCAACTGCGGACTGGGTCGATAGTTGCTTGGACGCAGCTGGCGTTTCTTCAGGAACTCATCCCAGGACAGTTTCTTGCGAC
AACCCTTGGACGCAGATTTTCCCTTGGACGCAGATTGCTTGGACTTGGATTTGCTGGACCCCGCGTTGCCCCCAGTGAGATCAACCGTTTTCTTGAGCGG
AGGAACAAGCTTGGACGCAGAGTCGCCACCATTGGCTTTCTTGCGTTCAGTTGCGTAGTCACCACAGACACACTGTGGCTGGTCGATGGCCACCACGTGG
ATGTTTGTAATCCCGCCAGCAGGAGGCGTAGTGCCATCCGCAAAGTGTCCGAACAGCTCCTGAAGGCGCTTCCAGTTCCCTGCTACCGTGACTTGTGGTT
CGCGATCCAAGAAATCGCTGAATGCCCATGCGCCCAAAGTCTTCTCGCGAATCTCTCGACACAGAACTTCACACAAAGCTTCAGACGTCTGCAGCTGGTC
CTTGAGTTCGGCAATTTCGTCTGCACGCGCATTCAGTGCATGTTGGTGGTCTTCTTGCTGACGGATGAAATTCTGCTTGAACGCGGATTCGCCATCCTGC
TTGGCCGCAGTGATGCGTTCGACCTCCTCCTTCCAG