Description :
From Genome Similarity Track
Location :
Scaffold_961:3344- 4639
Sequence
1295 bases(100 bases per row)
AGGAGTAACCGTTCTGGAGAAAATCCCGTCAGGGCTCCGTCAGCATTTAAACTGAGTAGCTCGCCGGAGATTAGGGATCCGGTACGCGCCGAGCTGAAGA
CCTCAGTTGCACCTGTGGGAGCCGAGCTCCAGGTGTTTGCATTCGTCGGGATAGATTCAGCTGATACCGACAACAAGCTGACATTGCATTTGCATGAAGC
GCGTTCATTTCTTGCTTTtGAAGTCAACGATGTGGACGAGGACTCGTGTCCCGAGGAGATGACGGGAGCCCGGgTTTTGCTCTACACCCCGGTGAACGCC
GAGGCTGGTGGTCTCACCACGACAAACCCGTCGGGGACACCAGGATCTCGAGAGTCCACGGTGCCGTGTGTGACCGCCGCGTCCCGATCCTACTCGACTC
GGGATCCTCGACGAGTATGATCAGCCTCGATCTCGCAAGACGGCTCGGGATCCAATTGAAATTTGGGACCGGGATCCGCATGAGGGGAATTGGTGGCGTC
GTCACACGAGTCACGGCCCGAGCCAAGATCAAGATAACGCTGGGGATGAGTGTCGTCTACTTCATGGAGGTTTGGGCCGCCAACATCGGTGAGGGTGTAG
ACTGTCTTCTCGGGATGGACTTCATGGTCGCCGCGGGCGTACGCCTGAGTGCGTACGAAGGTGCAGTGCGACTCCCAGACGAGGAGCGGATACCGCTGAT
TGCGTCAGGATCCCGACCTGGTCTCCCGGGgAAGATCCCGATCTCGTCCGCGACCGACATCTCCcTTAGCCCGGGAATGTCGACTTCTGTCCCAGTGACA
AGTGGTCGAGATCTCAGGCTGGAAGCTTGGGGATGCCGAGGCgACCGCTGGGTCACGACAGTGTTAATGGAGCACGGCGTCCCGACAGCAGTCCGGgTGG
TAAaTATCTCGGGACGCCAAGTCAGGATCCCGTCAAGGACCCCAGTCGCCCACCTCGTCGAGCCGGGACACCTTCCCGACGCTGACCGCTGCGCTCGCCC
AGGCACCGCCCGGTATCAGGAGTGGCAGAGTCACATCTACGAGAGAGCCCTCTCTCGGAGAGAAGTCCGACGTCGAGAGCTGGAAGATGAGgCATtCAaC
GCGTCGCTGCCACCAACAGTCGAGAAGCACGAGTACCAAGCACCGACCAGTATCCTTCGCAGGGGTGAAAGTTTCGAAGAGCCTGACATTGGGGATCCCA
ACACTGGTCGGGACGCTGACGTTTCCTTGGAAGAGGTGTTTCTCTCTGTTGCCGCGAATCCCGACCAAGTCGACTACGATGATGCCGAGGTATCC