Description :
From Genome Similarity Track
Location :
Scaffold_57:334363- 336605
Transcript NameFunction/comments
Physo_137806reverse transcriptase

Sequence
2242 bases(100 bases per row)
CAGAATCTCCAACACTTCGCTCTCACCGGCCAGACAATCAGGTTCCCAGCTATCTTCGGGGAGTAATTCCTCGTCGAAGTCCAACCGTGAGTCTTCGGTG
ATGTCAGGCGCCAGTCGAGTCTTCGGGCGGTCTTTGAATTCACTCACCGGCTTCAACCGCGAGACCGGGTAAATCCGATAGCCGCTCCGGTTCGGCAACT
CGAGCTCGTAGGCGTACTATTCGACCTTCTTCTTGATCCGGAACGGGCCGTGCCAGCGGTGGGCCAGCTTCTTGGTCAGCCCCGGCTTGACACGTTCCAT
GTACAGCCATACGCGACTACCCGGCTCGAATAGAGACATCGGCGCGTTGCTTGAGGGGTCTGAGTCCGCGTCCTGATTGGTTGGCGTTGCTGTCTACGAC
TTGTTCCTGCCAGTCGTCGGGATGGTTGCTCTCTCCTTCCGGCTCAGTGCTTCGTTATGTTCGCGTGCTCGGCGGGCTTTTTCAGTCGCTTGGTATTCCT
TGGCCATCTCGAGTGCAATCTGGTGTTGTCGGTTGACGTCCCGGCGCCACGCCAGCGCGTCGGATTGTCTGCTACTGGCTCTGCGGAGCGATGACGACAT
CGCTTTCAACGTCGACAGAGCGTCCCATCCATGGACGAGGAAGAATGGAGTTTCCTTCCGTGTCATGTCTTGTGAGTTGTTGATCGCGAAGACCAACCGT
TCCACGATCTCGTCCCAGTCCTGCTGAAGCGGGTCTTCGGCGTACACTCTCACGGATTGAATCACCGTCTTCACCGACCTCTCTTGCTGCCCGTTGACTT
GGGGCCGATAACTCAGCGTAGCCCGCGACCTTGAGTGCATCATTTCGGCAAAGGCCTGGAACACCTCGCTCATAAAGCGAGGATCCCGGTCGTGTCTAAC
CAACGAATGTGCTCCGAATCGTCGGTATATACACTCTTCGAAAGCTTGGGCTACCTTGAGCGCTGTCGTGTCCGACATTGCCTTGGCGATCACAAATCCC
GTGAAAGCACATTGGAACAGGAGGAGGGCAGTGTTGCCTCTCCGAGTCATCGGGAGCGGTATTACGAAGTCCATGGACACAATCTGGAGTGGTCGCTCTG
CCAACACGTTGCCGGGAGAATACCCTCGCAACTGTGGTCGGCTTTTGCTGGTGCTGCAGTCCGGGCACGACTTCACATGCTTCTCGACGTCTGTGTAGAG
GCCGAACCAATAGTAATCCCGCTTGACTCGCTGGTAGGTCCGCACTACCCCCTGGTGCCCGCCTTCTAGCGAGTCATGGCAGTTCTGCAACACTTCTTGA
ATCATCGTGGTGGGTACCACGAGACGCAGCTTGATCCCCTCTTGGTCTCCAGACGTGTCTCGACGACTCGAATTCACATTGTAGAGTACTCCGTCGTCGG
ACAGAACGAACTTGTCCGCAATTTTCCAGGCATCTCGTGCAGCCCTGTACCCGAGCTTCTCGACCTCGCCTCGGAGGACTGTTTTCTGGTTTTCCCACCG
TAGTTCCTCGTCCTGAGCGGCTGCTATGCGCCGTCGCCTCTCCGCTTGGACTTCGACGGGGTCAATGTCTTCTGCCTTTGGCGCTGCGGGCGGTGCTTGA
GCTGCTTTCGGTGGTCGTTCATCAGTGTGCTCTTTGTCGGTTTGAGTCATCGGCTTGGGTGGCGTCTCGTTCGTACTGTCGTCCGCAAATCGGACTCGCT
TCGTCTTCGATCTAGCCTGTGAACGAGTCATCGCCATGATCCTGAAATGTTCTTTGCGCACGAAATCAGCGAATGTCCTGGGTTGGTGACCTCGTATCCG
TCCGCAATGTGAATAGAGCCTCCAGGAACATGGTTTTGCACTGTTGCTTCATCTGGCGTCGACTCATAGATCACTTCCTGGATGCGGTTCCGTTCGCAGA
GCTCTGCCTTCCGAGTTTCACTCAGGACCACCTTCGACGTCTTGGATTCAAGTGTTTCCGACGCCAATGAGTCTGCGGCCGCATTGAATTCTCGAACCAC
GTGCAGGTACTTGACTGACCGCAGTCGTGCCGTGATTTCCTTGTGGCGACTCAGCTGAGTCATCAGCGCCTCCTTCCGGCATGCGATCACCCCTAGGGAT
TGCTGGATCGCGAGCATCGAGTCCCCGACGATGACCAAGTCTTCGGCGCCATGGTCCAAAGCTGCAAGCACTCCGTTGGTCATGCCAGTGAACTCGGCGA
GATTAACAGTCGTCTTCTCGAGGTAAGCGCTCGCCGCAATCA