Description :
From Genome Similarity Track
Location :
Scaffold_205:33432- 35266
Transcript NameFunction/comments
Phyta_totarag5563notchless family protein
Phyta_totarag5564dynein light chain/pantothenate kinase

Sequence
1834 bases(100 bases per row)
TTACTCTCCGAAGGCTCCCAGAAGAACAGCGTAAAGTCGTCTGAGCCAGAGACCAAACGTTCCGGCTGGCCCTTGCGAACCTCTTGGTATCGCTTCAGCG
CCGcttgctgcatctcctcACGCGACGCGAAGCTTTTGGTCTTGTGGCCGAACGGTCCCGAACGGCAGACGTAGTCCACATTCAGAGCCAGCGTGTTGAT
ACGGTGGCCGTGTCCGGTCAGCGTGCGCACGAGCTTGCCAACGTGCTCGCCCTCCATCGCCCAGACCTTAATTGTGCGGTCACGGGACGCGCTGTACAGC
AAGCCTTCACCACCCCACTTAATGCACTCCACCGAGTCCGTGTGGCCCGACAGCGAAGCGATAGAGCGTCCCGTGCGAGCATTCCACACCTTGATCGACC
CGTCCTTTGATGAACTCGCAAAACGCTCACAAGTAGCATTGCGGTGCATGGGTTCCCAGGTCAGCGAGTTCACCCACTGCTTGTGGCCCTTCATGGGCTG
GCCGATCTGCTTGCCCGTCAGTGGGTCCCACAGACGAATCTCACCGTTGCGGTCCGCCGACGCAAACCGCGCTCCATCCGGTGACCACGCAGTACACAGC
ACGTGGTGCTTGTGTCCACGACCCGTGTGCTTCGGCATGCACGTGTTCGTGTCCCAGAAGCGCACGGTGGcgtcgccacctccactCGCCAGTCTCTTTC
CATCCGGGCTGAAACTTACATGGAGAATAGCCTCCGAGTGTCCCTGCAATGTGTCACTGCAACGGGTAACAGGACGCACACGGAATGCCGCCAGTGGTTG
GAACGTGATCGTCAACGCCGTCTCCGAAGACATTTTCTAACATCAAAACAATACAAAAAATTGAGTAACTTTCtcactggcagcagcagtagcagcttca
ccacacAGTAATTGCAGCCACGTACCAACTCCTCCACTGTAGACTTGAGCGACGTCGTCACCTCCGTCTCGCCAATGAAGAGCGAGTACGGCACGCGGTT
CTTGCcgttctgcagcagttcgttgaccagctcctccatctgcCGGACGTTGGAGGCCATGGGGATCTCCAGTTGCGGACCCACATTGGTGCCCTATCAA
CACACAATACACACATTTACGTAAGGTCTCTAGCGTTCGTTGGACGAGTGTGTCAACTGTCGCTTACGTCTTCGCTCTGGAACTGGGCGATGGCGGACGT
TCCGGTCTCATCCTCCGagtcctcgccgtcgtcgctggcatTGGGGCCCTCCGGCTTCATGGCCGCGTCGGCGTTGATGCTGGAGCCAATGGACTCGTGC
TCCActttcatcttcttggcgacgTGCGTGGCCATGGCGGCTGCTGGTGCAAATGGGTTTGTGTGTCAAAAACTGTTGGGCTGCAGCCGTTGCGATGCGA
TTGGTCGGAAAGCAttattttggccaatcggTATCCGTCTGTTAAAAAAGTActgaccaagttgaagtggtccGGTGCATGTCCGCGTGCAATAACTGAG
AGCAAAGCAACAAAGGAATCTAATAAAGCTTCGATCAATTTGTCAACACCGGCAATGAATGCCTCGAAGGCAGTGCACAACCGAAACAAAATATCCGTGT
TTTCGCATGGCTTCGACACTCGGTTGCGTCAGTCCCACCACTCTACACCCTCCTACCCTGCCTTGTAAATCATCACTGCTTTCTCATTGTAGTAAAAGAA
GACGAAGTTTCTCGTTACGTGAGTCACGAACGAGCCGAAGTTTCGGCCGATGCACACCACCCAGTGTGGGTCCCACGCCTCGTCCAAGTGAGCTTTGATC
TCCTCGCACACCTAAATAGTCCATGCAAAAAGAA