Description :
From Genome Similarity Track
Location :
contig_47:334242- 335278
Transcript NameFunction/comments
g7888.t1hypothetical protein

Sequence
1036 bases(100 bases per row)
CAACTCCTTCTTGCTGTGGTACAGCGGCAGATCCAGACGATTGAAGCATGCGTGACTCGAGATGTACTGCGTCGAGCGGTAGGGCACACCCTTGAGGTTG
AACGGGCACAGGCGACCATCGTAGCTGGTAAGACCCCGGAAACCCGACAGAGGGACACAGGCAGATCCTGTCGCGAACAGCAGCAGGCGTCGACGGTACT
CGTTCGGCATTTGGCGAACAATCTCCCAGAACCAGCGAGTTACGCTGACGCCCTCAAGGTTAGGAGACAATACGGTGTGAGTCTCCCAGTCCGTTACGTC
CACTTCGGGGATCCACACAGCAAGTAGTCGAATTCTTCTGGGTCAAAAATCAAAAGCATCTCGCGAGGAATAACCTCGTACAGACCCTTCAGGAATGCAT
GCAGTTGGTCCGCCACACTCTCGAAGAGCACGTAGCGGAAACGCCGGTCCAGGTACTCGCGCTTGTTGGCATCCGTGACAGCAATATCCCGTCCATTGGG
GATAAGATCCACCACGATTTTCTCGGTTTCGTTTACCTGCTCGGTTAGACTAAAGTCAAGTCCGAGGTCGTCCACGCCGTCGTTGTCCATCAGCCATCGG
AGACTGCGGTACGCCTCTGGGTCGAGATACTCCATGTCGGCAAACGTCACTGGCATACCCAAGATCACCTTCAGCAACGGCAGTGCGAGATGAAAGCCCC
AGATGCCGCCTTCCAGCAGAGCCCGACCAATCAGTCGACCTGTGGCAAAATAGTAAGCTAGGTGGTCCTCGCCTACCTCAGACCGGGATTGCGGATTGAG
AAAGTAGCTCTGGTCGGCCTTGTTGGTGCATGTAAAGAGTCGAAGCGTCGGCGAAGCCAGCAGCTCGTTCACCAGCATAAACCATTCGCGGTGCACCCCG
CCAGCATCCACGCCGCTTTCATCCAGGAAATTGATGCGCATGAAGGAGCGCAAGTTCTTCGGCTGAATGCAGTACATGTGGTCCATCGACTCTTCCAGCA
TGTACTCGCGGTGGACAGACAACTTCAAAAACTCCA