Description :
From Genome Similarity Track
Location :
Scaffold_46:334203- 341664
Transcript NameFunction/comments
Physo_136531hypothetical protein
Physo_136532hypothetical protein
Physo_136533hypothetical protein
Physo_157434hypothetical protein

Sequence
7461 bases(100 bases per row)
GGACATCTGCCGCTTGGAGGAGGAGTTCCAGATCAACAACTGGGGGCTTGTGGAGGGCGGTCACGATCTCGACCGCGTCAACTGCGCCGTGCGACTCTCG
AGCGCGTCCTTCCTGCTCTACCTTCTGGAGAACAAGCACTGAATTGCTGCTGTGGCCTCTTGAATATTGTTGATGCCTGTGCATCAAGAGAGAGTAAACA
ACACAGGTGCAAGTTTTGGGCTTCAAAAAGCTCAGGCCACTGTGAATGGTGTCATAGAGCTACTTTTGTTTTTACAGATATCCACTTTAAACTATTGGCT
GCGTGGCGAGCACATATGGTTGGCTACTTGCATCCTCCTTCTCCCCCTTATCTTCCTCAGGGTTTTCCTCTTCAGGCGCTTCGTTAGCTGAAGAAGCTTT
ACCGTTCTTCTGCCGGCGAACGTAGACAAATCCAGCACACCCAAAAACGAGGATGATGATCACAACAGGGATAATAACGCGGAGGTTGTGCTTCCAGTCG
GCCTCGTAGCTGTTGCCTTGGCTCGAGGGTTGCGGAGGAGGTCCAAGGTGCGAATCCGGACCTGGTGAACATGCAACTCCTCTCACGAGACTGATCACAG
GAGCACTCGTGGAGTTCAGACCCGAGAATGCCGTTGCAGATTCATCGCGAGGGCAAATGCCATTAACCAGACGAACAAACATGCGGTTCGAAGCTTCAGG
CGCCATCGAACTGGTTTTAATGTGCAACTTCAGCGCGGCCACGACTCCATTCACTGCCACATCGCCCTTCAGATAACTAACTGGCAGCAGTCTTCGACAC
AGCCGACGTAAACGCGACAGCGATAGTATCATTTCCCCCGCACTTGGCTGCCAGTCGATCTTCCAGATCAACCGCAGACAACGCAGACTTCGTGTCCGGC
CACGACGAATTCCACTCTGCCACCATAGCACACACCGAGAATTGTCCGGACGGCTTCTTAGTGCGATTAACAGCCTGGAACCTCGCCCAGTACGACGCAA
ACTTGCCGCTCTGCGTTCCTTCGTCGAGCAGGGTCCAGCTCGCTGCCTGGTACAGAACTCTGCTCTCTGCAGCGGCGGTATAGCTAACAACACTATCGAG
CCACGAACTGGAGACGGAGGAGTTCGCCACCAGCATCACATCAATGGGCTCCTCGTGATCCGAGGGTCGTCTGCATACTCGAACGAAGAAGAAGAAGTCG
CGTTGTCTTGGTCTTGGCCACTGGAAACGGAGACGACGGTGCCAATGCTGATGGCGGGCGGGCCATGACCGGAACCGCTGCAGCTTGACGAGTCTGCGTA
TGCATAGCAACTCGTAGCTGAGAGCGCGAGCAGCAGCAACCCTGAGGTAGTTTTCACCATTTTCTGCCCGACGTTTGCGAAGTGAGGGCTGCAGGGACCT
GGGCGGAGGGAGGGAGGGAGGGATACCCTGCCTACCTCAACGCGACCGGGCAGAAATGAGCCGAGGTCGCGTCCGCGTTGCGGAGGAAGTGCCTCTTCGC
CAAGAGCCAGCTGGTTGTTGCTTACGGTCCGCCCGTGAAGCTGCGACTTTCGAACAGCAAACTGTGAGCAGCACCCTTCCGATCAGATATGCGTGGCGTT
AGCAGAACACCCTGCCAAGAAGATGACTGGGATAGCAAAGCTAAGGTCATGCTTCCAGTCGCTCTTGGCTGCAGTTTCGGATACAACATGAGGCGGTATG
GGCGCCGAGCCTGGGAAGTCGGTGCATGCGTTTCCAGTGAGAAGACTTACCACCAAGACTTCCATATCGCCAAACGAAGAGTGTGGTGTAGTTGCAGTGG
ATGCATTTCTCAAGCAGATACCACCTGCAAGTCGTATGAAAATGCGGTCATTTCTCGACGAGGCTTCAGTCACATCCGTGTTGTCCACGTCTCGCAGTCG
CCACGGCATCGTTGGCCTTTACTTCCCCCTCCAGATAGGCATCGATAGTATCCGAGATAGCTGCTGATGTGAACGCCAGAGCGACAGTATCGTTCTCATC
GCAGGAGGCTTTCAAACGGGTTTCAATCTCAACGGCAGCTAGCACAGCTTCGTTATCGGCCCAGGAGCTGACTTCCCATTCCACCACCATAGTACACATC
GACTCAGACGACGATAGTGTAGACTTCACGCCATGGAATCTTGCCCAGAAAGTCGAAAACTTCTTGTGCTGGGCTCCGTCTTCTAGTAGGGCCCAACTTG
CTGTCTCGTAAAGGACTGTGCGGTTAGCGGTGGCGGCATAGCCATCGGTAGCACCAAACCACTTTTCCGCTGTCGACGCGTTGCCCACCAGTACAAAAAT
CGTAGGAATCTCCATCAAATCGTAGGAATCTCCATCTTGGTCCGGCAACGAGGAGGCATGTGCTTGCTCTTGAGCAGAGATGACAGTTGCAATGTTGATA
GTGTCTACTGCATTGTCGGACTCGTGGAAGCTTGCATCTGCGAGCGCATAGTGGCTCCTGCCTGGAAGAGTCAGTAACAGCAAAACCCAGGTAAGGTTAC
TTAGTAGTGTTTCCGGGATGCCGAAAAATAAATTGGTGCTGAAATTATTGCAATAGATTTGAATCAATAATTTATTGACATGTTCTTAACCGCTACCTAC
CAGTTATCTTTTGAGTTGAGCATAACATCTTCGATTATGTATTGTGGGCTACTGCAGCCAACCATCCTCCAAACCCATGGCTTGAGCTCGACCATACCAA
CTCTCCCCACTTTTCATTCCACCGGAAGCCGACAACCCGCCACCAAGCCCACCACGAGCCGCCACAATGCTCGCAGACCCCCTTCCGCCTCGCACGGCCG
CCTTCACTCACAGGCAGGTCGCCAACTTCTACTTCCGGCCGTGCCGCGACCAGTACGACGAGGTCATTCTCGAGTACTTACGTTGCCGGTGCGGCGCGAC
CCGGAAGCGAGTCACCGGGACGGGGTACTCGAACCTGATGCAGCATAAAAGGCGCGAGCACCCCTCGTACTCGGAGGAGATGCTGGCCGCAACACCCGGT
CAGACGGGCTCTCTTGCTCACTACGTCCGCCACTCTGCCCAGAACTTGTTCGGTTGGCTGGAGTGGCTGGTGAAGTGCAACCTACCGCTATCATTTTGCG
AGAGCAAGCTCGCCAGACGGTACGACCCAGCTCTCTACTGAATATGTACTGTTTGACAATTAACTAATACTGTGTTTACACTTTGCATCTAGTTACACGC
GCCTCCAGCCTGTCTCTGTCGAAACGCTTCGGCGCGTCATGGACGCCGTGACGCGCTGCGTCGAGCACGCGATCGCGGCTGAGATGCCGGAGGAGTTTGG
TCTCATCTTTGACGGGTGGAGCCACGACTCGGAGCACTACATCGCGGTCTTCGCGTGCTACGAGGTTGATGGGGTTCTGAGGTGCCCCTTGCTCTGCATG
GCACCACTCGTCAACGATGAGACCGACGACTTCTCCGCGGCTAGTCATCAAGCCTTCTTGGCTACGATGCTAGCGCGCGACTATCAGAAGCGCCTGGACC
AGGTTCTCTTCCTGGTGGGAGATAATTGCGGCGTCAACCGCCGCCTCGCTACGCTGATGGGTGTCCCGCTAATCGGGTGTGCAAGCCACTGACTCAACCG
AGCCGTCGCCGCCCGGCTGAGCGAATGCGCTGAAGATGTCGACATGGTACAGGCGCTGATGGTAAAGCTGCGGACCCTCCACCATTCTGCAAAACTCCGG
TTAGTATTTGTATATTTCCTGTTATTTTTGTTATTTAGTGTGATTTAACTGAAATTGACACTTTGGTGCTTGCAGGTTCAAGACCGACCTTCGACCAATC
ATCCGCCAGCAAACCCGTTGGGGTTCGACCTTTGCGATGATTAACCGCTACTTCGAGCTTCTACCATTCATCGACGCGGAGGACGACGAGTTGGCCGAGC
TCCTTCCCCCGGCGGCGTCCAAGCGGCGGCTTCGGGACCTGCTCGGCGAGCTGAAGGACGTGGAGTCCTCGTCGAAGGCTCTCCAAGGCGCTGACGCAAA
CCTCCTCGACGTTTGCGCCTGGTTCGACGGGCTCATTGCCGCGAAGCCCTCGTACGCCCGTTATCTCGGTACGCTTTTTGTCTATTATGCGTTATTGGTA
CATTTACTAATATGAATTTGTTTGTATTGTATTGTAGTACCGCGGGCTGACATCGTCCACAGCCCCGACTTCGAGGCGGGCTGCGTCAAGGTGCTCAAGG
GGCAAGCCAAGCGGCTGACCCGGGTGGAGAAGGCGGCGCTGGAGCGCTTCTTGGCGGCTCCACCAGCAGGCGAGGGCGAGCAAGAAGAGAAGGTTGAGGA
GGCCAGCATCTCCTTCGTGGAGCGGCTGCAAAAGCGTCGGCGCCTGGAAGAGCATCAACCATGCTACGAACTGCTGGCATCCATTCCGCCCACGTCCAAC
GATGTCGAGCGATTTTTTAGCATCGCTCGGGCCACGTTTGGGCTGCAGCGCCACGCAATGCAGCCGTACACGCTGGAGATGCTGCTGTTCCTGCGGCAGA
ATGCCGATTATTGGGATGCGCGCACTGTTGAGAGCGCGGAGTAAATGATAGGTATGTAACCCATCAATACACTGACCTTGCACCAATAATCTATTTTGCT
GTGTGAAGTATGTCAATATTCTATTGCGGGTTTGTTTAGTTTGATGTTCAATTATCTACTCTCTCTATTTGCTTGCAATAGATAACAATGCAATATTCGG
TAACCCTGCCACGAACTAATCTTAAACTCTCGTTGCTAGAAGCGAAGTAAAAGCGAAATGAACAGATCTTCACGCAAGGAGGGCTCTGGGATAGTCTTGA
GGAGCTCCGGCTCAGGTGCAGCCGCTGATTGTCGACAAGTGCGGCAGTGGGTGCCTACCAAAAACGGATATAACTCGACATAGAATGCATCAAATGTGCA
GAGGTTGAAATATGTGAGAGGTCGCCTGATATATGCGTTAGTTGCTAGAAAAAGGACGTCAATACTGAAAGCAAGTCAAATCTAATACGCTGCTATGCAG
CGACCCTTCGTTTACTCAGACGTAAAAATCGTCTGAGTAAATATAAGTTTTCTTAAATTTAAATATGTTGGGTGATTTGTTCGTTTTTGGTAGGCGTCCA
GTGGATATTCCTTTCACCGACTCATACGATAAGGCAGGATCATACTGTAACCCAAACACCAGCGCCGACCCTACAAACTGATACCATTATTTTACTGCTC
ATTCATATCATTGCTACAAGCATTGCTCCTCATGCTACTGAGTGCATTGTCAACACGTATGGAAGGCTGGATGGCTCATCCTTCTCCACCTCCTTGGGGG
CTTCCTCTTCGGAGTCCTTCTTCTGCCGTCGGTAGAGGAAGATCAATCCGGCGCACCCCAGCAAGAAGAGAAAAACTCCAATTGGAATAATGAACCTGAG
ATCATCTTTCCAGCCCGAGTCGTTGTCGCTACCATTGCCCTCACTCGGGTTCTGGGACGGCCCGAATCCACTGCTAGCCTTGCATACCAGCCCCCTGAAC
AGGTTTATCACCGGTATTCCAGCTTCAGCCAGAGAGTTTAGCTCGTTGGCAGACTCATCTCGAGGGCAAAGACCGTTAGCCAGACGAACGAACATGCGGT
CCGAGTCTTCGAGGGTCAGCGAGCTGTCGACATCGTGCATCTTCAGCGCAGCCACGACGTCATTCACCGCCACTTCCCCCTCCAGATAACGAGCAGCAGT
CTCCGACACCGCCGATGTGAACGCAAGAGCAATCGTATCATTCTCCCCACACCTGTCCGCCAATCGCTCCTCCAAATCGACCGCAAACAGCGCAGATTTC
GTGTCCGACCACGACGGATTCCACTCGGCCACCATCGCGCACACCGATAAATACGCAGACGTCTTGACAGTGGGGTTCACTGCCTGGAGTCTCGCCCAGT
ACGATGAATACTTGCCGCTCTGCGTTCCTTCGTCGAGCAGGGCCCAGCTCGCTGCCTGGTACAGGACTCGGCTCTCTGCGGCGGAGGTATAGCCAACGAC
GCTATCGGCCCAGGTGCTTGAGACGGACGTGTTAGCCACCAACACCAAGTCGATAGGGTTCTCATACTCCGCGGACATGCTCGAGTTGTGCTGGCCTTCG
CCATCGGAGGCGGAGGAAACGGTCGCGATGTTGATCCCGTGCACTGGATTATAAGACCCGCTGAAGCTCGGCGAAGCCGTGATGGTGTGGTGGCTCGCAG
ACGCAAGTGCCAGCACTAGCGAGAACGAAGCAGACTTCATGGCTTGAGGACTGGGCGGGTGAAGGAAGAAGCCGAAGTGAAGCGCTTAACGCCACGAGTC
GGGAAGGGGAGAAAAGTGCACAGAGCTCCCAGCTGTGGTGCCGCGAGGCATTGCTAACGCCGCGTCGCGCAGGTTCTTCCAACGGCCCCCATCAACAATC
GTGAACCTACAGTGTATCTACAGGGTACATGCGCTTTACGAACAGCAAACGGCTTCGACATTCAAGCGTAACGATGAAGTCCGGCTACAGTACATGTAGA
GCGAGCAAAATAGCCGGTAGAAGAAGCTTACGAGCTCTTTCGATGCATTGATTGGAGCTTTACATGGACTAGAAGGGTTAAAGTTGTCCCGCTTTGTTAA
AGTCGCACAGGTAGACGCGCTTGCTGCATTGCATCGTCCTTTAGTCTACCTAAGCTTCTTGCTCCAGCACTGTCTTGATGGTATCGACTGAGTGTTTCCA
CACGATCTCCTTCATCTCCTCCGTCTGGAACTTGGTCGGCTCGAGAGGCCCCGCGTTCCTGTTGACCAGGTGCCAGCCCGAGCTGAACTCATCTTTGGTT
AGCGCCATCACCATGAACTTCGCGCACTCCTCCGGCGATCGAGCGATCACTTCCCCCAGAGCCTTTGCTGGAAGGCGTGCGTACCAGGGCAAGTTGTCGG
CAATTGAAGTTGCGACGGCACCGGGAGACGCGTGCATGAAGCTGGCTTGTGGTGCCTTCTCTGAGAAGGCTTGGGCCATGAGATCCCTAAGCCAGACAAC
CCACGAGGTCAGCAGAATACCAATACGACCGACAACTTGTCATCACGTACGAATACGTAGTCGTGAAATCAGCGCAGCGCTTAATTGAGAACGTCTTCTT
GAGATCCAAGTCGCTCACATCGGGCTGCCCGCCGGTCGTTGGTGCCAAGATATTGAGCACACGCACGCCTGGACGATCGAGCGTCGACAGCAAGTCGTAG
ATGATCATGAACCTACACGTTTTGATAAGATCGTGACAAAGTGATCAATGGGAATCTACTCAGAATGACAAGTGCCGTCCGCTCCGCTCACCGCCCGTAA
TAATGCGTGGCCATCTTGACGTCGAGCCCCTCGGGTGTTCCCGTTCGTCCTTTCAGCGACAGAATACCTGGGGACATGATGATCCAGTCGAACGCTGCCT
CCTTGTGCGCGTCTGTAAACTTTCGAACGTCGTGAAGACTCGACACGTCAAGCTTCACGTG