Description :
From Genome Similarity Track
Location :
Scaffold_2084:3341- 4956
Transcript NameFunction/comments
Phypl_g14653Amino Acid/Auxin Permease (AAAP) Family

Sequence
1615 bases(100 bases per row)
gaagGCTTCCGGGAAGAGGCCATCCAGGAGCGTGCCGCCAAGCACGAGGAACACGCATGGCACCAACAGGCAGTTGGCCATTTGAGAGACAACCGAGAGG
TAGCGGCCGGGCTTGCCCATGCACCATTCTCCGAGGTCACCGTAGGTCTTGACGGAACGCGGAGCGATCAGCATGACACGGCAGATAGCCACCGAGGAGT
ACGTGTTGGCGAAGGCCATAAAGGCCATGGCGATGATTGCGATCACGGGGCCGGCACGGGAAAAGTTACCGGGCATACCAAGCGTTCCAATGCCAtagac
gcagcagaagaggttgaacgccgccttggcgtcTTCGAGCGTGAAGAGAGCAGAGTGCGCCATGGAGAGTCGGTTAGGTTGGTCGGTTGAGGCGCAGGGG
GAAAATCGGAGACTGAGCTTCAATGAGGTGGGCGACGACACCTTCTCGGCCCCAGCTCAACGAACCGGTCAACTAGCGAAGTTCTCAGGCGATATTCGCA
CAAACGGAGCGGAATGCGCAAGCTTAGCCAACGCAGTGAACCCTGCTGCGAGCAAGAGCCCGGCCGCTATCAGCCGTGCCGGCGACGTCAGATCGCGATG
GGCCTATGAGCGCGCCCAACCCCCCAGCAAATCCCTAGCACCGCACTTTCTGGTGCGGCGTTAAACGCTGCCGCACCGGCACTCGCACCACGACACCGGA
TTCTGTGCGGTCATGAACCTGACGGCAAATCAGGACTTATCTCCCCAACTTGGGGCCCAAGCGCACCAGTGGCATCTTACAGGAGGCTACGTGTGAATGG
AATGCAATTGTCATTGCTCAcaggagcagctcggcagCTTAAAGCGGAAATATCGCGGCTGGAGAAAGCGCGTGGCGCTTCCGGCGCTTCGGTGCTGGCC
AGGCAACCACAGATAGCGCAACTTCAAATTCAACATCGCGATTGCCCGGCTTTGAAAGCGAGTCTTTTTTGCATGCCGGTGTACAGTATCGGTCGAAGCA
AAGACATGCACATGAGCGGAATTCCACCGTTCAGTTGACAATGGACAATTTGGAGTCGAAGTTCCAAGTTGGAACTACAGTACGTGTGTTATTGCAGTGC
GTGAGCTCACGGGTATAGCTTCACGGCCGCGATGACACGGAGACCATCGAGCGAGTGCAGGATCGTCGGTGACAAGTTGCGCGGTGGCGGGCTGCGATTG
GTGTCTGCAGAGAGCGTTCCCGTTCGGTAAACAGCCGCGGAGCCCATCAACACCTGCACCGGATCTCGAAGTTGCCTTCCCGCATTCGAAAGGATTCTTC
TGTTGGTACAAGAAGTACTGTACGTATTGCCTTGGCACCAGACTACTAGAGACATACCCATGCCATCGCACCAGAACGCGCCAGCCTGCTAATAGCAAAC
ATCGCTCGCCCCGGCGAGACGCTTTGAGTCTCGCCGGGGTGATGCAAAGCGGCCAAGTCTGCCATGTTGAACAAGGGTCTCTATAGAGAGGATTCGCGTA
CAAGCGTCCTAGAGAGATACGGAACCTCCTGCTGAGACCGACCGGTCTATGTCGATCCCCGACAAGATcgcatcgccaaggcgcgcCGAGGACCTGGTAC
CCCTCGGAGCGCTCA