Description :
From Genome Similarity Track
Location :
Scaffold_2048:3341- 4919
Transcript NameFunction/comments
Phypl_g14600hypothetical protein PHYSODRAFT_486841

Sequence
1578 bases(100 bases per row)
AATCTGAAGAGCCAAGCTGAGCATTCGATCCAGGCTGGACATATCGTTCGTCGCCCTGTGGTCGAGTTCGACCACCCGGTTGTCCGCACGCATCCTGTGA
CGAAGCGAAATGCCCTATTCGTGAACGCTGGATTCACCAAGCGCATTAAAAATCTGTCAGCGGCTGAGTCTGGTACGTGACTTATGTTTTGGATTGTATG
TTGCTATCTGCTATGACCCCCCCCTCCCCATGTCTACAGACGCGGTACTGCGGTTCCTCTTCAAGCACGTGGCTGAAAACCAGGAGTTCCAAGTCCGCTA
CCACTGGACGAAGGATTCGGTGGCGATCTGGGACAACCGCTCGACTTTCCACTACGCCACCTTTGACTACTTGCCGGGAAATCACCATGCTGTCCGTGTG
ACGCCGCACGGCGAGATCCCATACTTCGACCCGGAAGTTACGACTCCGTAATTAACAGGAGATGCCTGCAAGAGGAGGCAACGATCGAGTGGAAAACAGA
AAAAAGTTAAATCCGGAAATTGCATAATTGCGATGGTATTTTGACAGCGGCATCGTTTGAATTTATTAGGTAGGATGGCGCAATAATTAAAGCATGACTT
AGATCGATGTAGCCTTGCGCCCCACTAGTAGCCTCGACCTCGTTtgtttgaagctgccgcctgCGATTTCAGATATTTAGAGATCAAGCATACAATTGTA
ACGTCTGTACCTTTCAGCACATCACATCTTCCAAAATTCTGGAAAAAACAGCGATCACGCTGTGGAGACGTGttgcggcggcgcagctAAAAAGATGTAT
AAGTTTCGGGACTACCTACGAAGACCACAGCAGTAGGTTTGAAATGCTAAGCTATCAAACGACACCAAATACGTTGGTCAATTGAAGATGCCGGATATAG
CTGTTCCTTCACTTTCCATCTTTTTAGCCCATTTTCTCCCTCTTCTTACAGGCACCGCCTGTTATTGGCACTCGTTATTCAGCCCGAATGGGTCCCATAA
AAGCTCCATTTTATACGTATAGTCCGAGTATAGGACGGTTAAAATTGGAGTAGAAGTAGGACACtagcgcgttggctctcNCaggcgctgtgtctgggaT
TAGATATTAACTCCTGGACAGTGTTGCCAAGACCGCGTGAATGTTCCTTTTATGCATCGTTATCGTATACGCATGTATAGCTGGTAAGCTATTCGGGCAT
AATACTAACTCTCCCTGTTAATAGCTCGCCTTTCCTTTGACGAAGAATTTATTTTGCTTTTTTAACgaatttccataattcaGTGAATAGGGAACTTTCG
GAGAGACCAGATTTCAGGCTCAATTTGAGATACACGATGGTTAGGTTTCCGAAAATCACTCTCAAGACCAATCCGTTCATGATTATcgaagccccccccc
ccccccccccccctcggGATGCAGTGAGTGGGTTTCGCGAGCGCTGACCCGGCTGCGCTGGTGGTCTTGCTTGTGTGTCCAAGCTGGGAGAAGACACCAA
ATGAGCGAATTGCCTACTACCTAATCCTACCGCCAGGTCCAGTAGTTACGGACAAAACCTCTCGTCTTTGATCGTGCG