Description :
From Genome Similarity Track
Location :
contig_47:334085- 350113
Transcript NameFunction/comments
g7888.t1hypothetical protein
g7889.t1amino-acid acetyltransferase, putative

Sequence
16028 bases(100 bases per row)
TTACAATAGGATTGCTATTGGGGGTTCGATTATCCCCACCATCAGCTCGTAGATACACGTTAGTCGGCATGCAGCGGCGCTGGACGACGCCGAGCTGGGG
TTATGCCGTCGTGAAGCCCGTGAGGTCCGTGTCCAGCGTCGCGTACAGCATACTCTTCAACTCCTTCTTGCTGTGGTACAGCGGCAGATCCAGACGATTG
AAGCATGCGTGACTCGAGATGTACTGCGTCGAGCGGTAGGGCACACCCTTGAGGTTGAACGGGCACAGGCGACCATCGTAGCTGGTAAGACCCCGGAAAC
CCGACAGAGGGACACAGGCAGATCCTGTCGCGAACAGCAGCAGGCGTCGACGGTACTCGTTCGGCATTTGGCGAACAATCTCCCAGAACCAGCGAGTTAC
GCTGACGCCCTCAAGGTTAGGAGACAATACGGTGTGAGTCTCCCAGTCCGTTACGTCCACTTCGGGGATCCACACAGCAAGTAGTCGAATTCTTCTGGGT
CAAAAATCAAAAGCATCTCGCGAGGAATAACCTCGTACAGACCCTTCAGGAATGCATGCAGTTGGTCCGCCACACTCTCGAAGAGCACGTAGCGGAAACG
CCGGTCCAGGTACTCGCGCTTGTTGGCATCCGTGACAGCAATATCCCGTCCATTGGGGATAAGATCCACCACGATTTTCTCGGTTTCGTTTACCTGCTCG
GTTAGACTAAAGTCAAGTCCGAGGTCGTCCACGCCGTCGTTGTCCATCAGCCATCGGAGACTGCGGTACGCCTCTGGGTCGAGATACTCCATGTCGGCAA
ACGTCACTGGCATACCCAAGATCACCTTCAGCAACGGCAGTGCGAGATGAAAGCCCCAGATGCCGCCTTCCAGCAGAGCCCGACCAATCAGTCGACCTGT
GGCAAAATAGTAAGCTAGGTGGTCCTCGCCTACCTCAGACCGGGATTGCGGATTGAGAAAGTAGCTCTGGTCGGCCTTGTTGGTGCATGTAAAGAGTCGA
AGCGTCGGCGAAGCCAGCAGCTCGTTCACCAGCATAAACCATTCGCGGTGCACCCCGCCAGCATCCACGCCGCTTTCATCCAGGAAATTGATGCGCATGA
AGGAGCGCAAGTTCTTCGGCTGAATGCAGTACATGTGGTCCATCGACTCTTCCAGCATGTACTCGCGGTGGACAGACAACTTCAAAAACTCCACTTCTGC
AGGCACGATCAGCGAGGCCGTGCTGACCACAAAGTGCGCGTACTTTGAAGGAAAGTCGCTAGTCGCCAAAGAAACAACCTCCTTGCGTCGCTCAGCCCAG
CATCGGCGAGCGTCGACTTCCCGGTCGCGAAGTCAGCCGGGTCCGAGACGCTCGCCTCCACCAGCTCCAGCTCCACGTCCGTCGGCAGCATGGGCTTGTC
GTCTGCATTTTCCTTCTCACTCTGCGGTTGCTCCACAGCCAGACTCGGCACTGGCTCCGTCTCCGTCATGGTTTCCTGTTCCTCCTGCTCTTTCCTCTCC
TGCTCTTGCTCTTCGGCCAGTTCCTGCTGTTCCACTTCCTCCGGGAGCTTGAAACTCAGTGTATACCCCGGCAAGAGTGTGTCCACGTCGCTGTTCGCAG
GCACGTGGCCTCCGCCTCCACTGCGGTACCAGAAGAGATTCCCTTCCACGTCCAATTTCCTCGTCCACTCTCGTCGGCTGCGCGCACGCCGCTGCTGGCG
ACTCAGCGACGACATTTTCCTCGGACGTGGCGACAGCAGGTGGGTCGCGCTCATGGCCATGTTGATGGCTCCTCCTCTGCTGCTGCAAGTGTCCTCCGGC
TTGAGCTGCTCGTCGTCGCTCTCGTCGTCGGCCGTGGCGAAGGACAGCGACGGCAGCTTGTCGCCGCACAGCACGCAGTACTCGAAGCGCTTGAAGTTCT
CGAACGCGCAGCTGGCGCACACGCTGTAGCCCGCCTCGGCTTCTCGCGTGGCAGCGTCGATTCGGTGGTCGACCGACTCGCCCGACAGCAGCGGCACCTC
CATGTCCAGCAGGTGGCGGTTGCGACGACACGCCATGAGCCACACCACGAAGAAGATGATGCACAGCAGCAGCATGCCCACGCCCTGGTACAGCATCGAC
GCCTCCGTGGACCGCTCGTTGTCCATCGCGGCGAGTCTTCAAGTGCTGCGGTTCAAGTCAGTCACACGCAGAATGACCTTCGCTGAGGGATCCGTATTTT
TCACTTGGTTTCAGTATTGCTAAGTCGCGTTTATGCACACTAGATTACGGCGACGAATCCCCTCGAAATAGTGACAATCCACTCACAGCGACATGTTGAC
GGGGCTTGCATGTTCCGTCACCGGTTTCCCCTAACGGCAATGTACCAACGTTGGTGCGCACCCGATGGCTCTGCTTCAAACCATGCGGTCAAGTCACTGG
CTGCCGTTGTTCCTGCCAGCACTTGTGACGTCTGGATCGGCGATCCGACGCGTGCAATCGGTCATTGGCCTCTTGGTCAATGGTCGGACATCTGCAGGCG
ACCTGCACTTGCATTCCGTGAGGAAAACAGGCCGTTGTGACAATGCATCTCCACTGTCCTCCACGATGACGGCAAGACACGCCGCTCATAATTTGCAGTC
GATATTTAGGTCTTTGGATACTCCACGCTGCCGACTTCCTACGCCGTCGTGAACCCGTACGTCTCGGTGTTGAGCGTAGCGTGTAGCACCTCCTTGAGCT
CCGCTCGCGATGATGCCAACGGCACGTCCAACCGGTTGAAGCATGCGTGGCTTCGAATGTAAGGGGAGTGCACGCCCTTCAACGTGAACGGGCAGATCTG
ACCGTCGTGGCTCGTCAGGTGTCGGAAGCCACCGATCGGGACTCGCGAGCACCCCGTTGCAAACTGCAGCAGGCGACGCCGGCACTCCAGGTTCATGTCC
CGCACCAGCTCCCAGAACCACCGAAGCACTCGCGTCCCCGTCAAGTTCTTGGAGCACCTCGTGTGTGCCTCCCAGTCCGTAACGTCGATGGAGTCGCAAC
CGCATAGCACATAGTCGAACTCTTCCACGTCAAAGAGCATGAGGATCTGCCGCGGAATCACTTGGTACAAGCCTTTCAAAAACACGTACAGCTGGCTTGA
AACGCTTTCTAGAAAATGGTAGTGGAGCCACCATTCTGCGAATTCGTGCTTGTTTTCATCGGTCACCGGGATCTCGCCACCGTTTGACACCAAATCCACC
GTCACCATGGTTCCACTTGCATCTCTGCGCGTTGTCGTGAAATCTAGTCCGAGCGTCGCGGCACCATCGTGTTCCAACATCCACAGAAGACTTTTGTACG
TCACCGGATCCAAATCCCCGTAGTCGCGAAAAGTGAACGGAATACCGAGAATGAGCTTCAATAGCGCTGGTGCAAAGTGGAAGCCCACCACTTCGCCCTC
TAATAGCGCACGGCCAACAAGACGTCCAACTGCGAAAAAGTACGCTAGATGCTCCTCACCGATCGCCTGCCTCGAATTTACGTTGAAGAAATACGTCTGG
GCCGCATGGTTCGTGCAGGTGAAAACCCCCAGAGACGGGTCAATAACCAGCTCCGTCACGAGCGCGAACCATTCGCGGTGCACCCCCCAGCATCTACAGC
AGTCTCTGCAGCAAAATCAATTCGCACCACCGAATGGGTATCATTGTCATCCATACAGCACAAGTACTCCATGGACTCCTCGACAACGTGTTCACGACGA
AGAAACAGCTTCAGCACTTCCAGTTGAGGTGGGACAATCAGCGTAGAAGTACAGGCCACAAAATGTGCGAACTTGGTTGGGAAGTCTTCTCTTGACAAAT
TGAGCAGGCCCTTGACGTCGACATTTCTGGACGAAGGTGGCCCCGTCGCGAATGCTAGTGCGTCGGCTTCGTCGGCAGCCACAGTCTGTATTTTCATCAG
CTTCGTTTCGTGTTCCAGCTTCCTAGTTACTGAACCAGGCTCTCCGTCCGGTATCACGTCCACCTCAGTCTCCATCTCTCTGCCATCTTTGCCACCCCCT
TCCTTGAACACAGCAACATATCCAGGATACTGGGAGCAGTTTTGAGACGCCTCCGCATTCCGATACCAACAGGCCTTTCCGGTGCAGTCAAGCTTGCGTT
GCCATTCTGTTCGACGCCTAGCACACATCACCATATAATAAAATAAGAAGTCAGCCTGCGGATCAAAGCATACACAACAAAAGACCAACCAACAACGCAC
TTTGCCCGCACTTGTCGAGCGGTAAGAGGGCTTCTTGCCCGAGATCTCTCTGTCGGTGACAGCTTGAGCTTCTCCCCGCAAAGCACGCAGAACCTGAACC
TCTGTGTGTTTGCGAATGCACACACTATGCATCGTACTGCCTCCTCCTCTGCGTCCCTGCAAGCAACCGCCACCCCGTCTCAGTCAGCAGCGTGTCCTCA
ACACCCCAACCGACCTCCGTCAGCCCCCCATATCCTACGTACAACGTTGCAACATCAATGCGATGCTCTCCGGTCGCATCATCTCTGCAGAAGCCACATT
ATCACAGCGTCAACACCTCAAAATATAAAAAATAAAAAAACAACAACAACGAGGAATCCGCCGCCTACCTGGCGATCAATGCCTGCTGCAACTCGCTGTA
GCTGCGCTCGCGGTACTTGCGCTGCAGTTTGCGGAAGATGTAGGCGACGATAAGGTATAGTGCCACCTGGGAGGCCACGATGAGCACCACGATCACGTCC
GCCATCTTCGGAGCTTTTCGCCTTCTTCAAATTGAGCACAATCATTGATGTCGATGATAGTCATTAATTCGAGGGGAACTCAACATCGATAGAGTCACTG
AAGTGGTGCATACAACTATATCATGAGCGGCGCACTGAACGACAAGAGCGCGCTGGTGCTGGAGCTGGGGGCACGTTACGCGCGATGCGGCATCTCTGGG
GAGCGCGCGCCTCGCTGTATCGTGCGCTGGCAGGTGCGTTGTCACCGTATTGCGCGCATCGGGTTCGAGGTTGCTCAAGGAGTATGTGGTCAGGTGGGGG
ACATGCTGCAGAAGCCCTTGACCGCCGCGGACTGGCGCCAGTATCTGTATCCGGAGCTGCACACGCTGTGCTTCGAGTGAGTGGTTTGGATCTGCATCGA
CTGCGTGGGTTGCGTAGCTAACAGGCTGCTGTACTGTCAGCTTGCTGTTGGTGAATCCGACGCGTCGCCGATTCGTCGTGTGTGAAGATCTGCTGCTGCC
GCGGGTATTCCGGGAGACGCTCTTGAGCATTTTATTTGATGTTCTCAAGGTGGTTATTGGATGAATAGAGAGTTGTGGTTTGGGGGGCTGAACAGGAGGG
TATTGTGGTTGTGCCAGGCTTCTGCGGTGTCGTTGGTGCCGTCCATGATGGCGGTGTTGTACGGTACAGCAAACCACACAGCTTTGGTGGTAGACTGCGG
CTGGGCAGAGACGCGACTGCTGCCTGTGTTCAAGGGTATACCGCTCCCTTATCTTTACGAGAGTAAGTTTGGTTACTAGAAGCTGTGGAAGAATGTGGAA
GTGACGCGACGTGGTGTTGCTGTGTTGAAGCTGTGCCTGCTGGAAGCCGGAACTGCTGTGAGTTGATTCAGCGAGAGCTGAATACGTCTCGCGACCAGCC
GATGGATAGCTTGAAGACCGTTGTCACGCCTGTGACTGAAGCCATTGCAGAAGGCATTCTTGAACGGGCGTGCTTCGCACAGCAAAAGGTACACCAGGAG
AGACTTCATATTGCCGAAGTTATATATCGCGGAGCTCATGTTTCTGCTGTTATGTGCTTCGTGGATCAGAATCCGTTGCCAAATGTGGTTGACGCAGAGT
TTCAGACCCACGACAATGATGTGCTGCAGGTCGGTCGCAGTAGTAAAGGCTTCATTTTCACTCGTTGCAGATTTCTGACGGTGTCTCACTTGGACCCTAC
TTGCGTAATAGGTTCCTGGAACTTGCGCACTGGAGCCGTAGAGCAGCTACTGATTGGTATGCATTCGTGGTATCGGATGGCCTGCTGCAATTCCTAACAC
ATCGATTCACCTCGCAATTCGATTGTTCAGGTGACGAAAGCACGGATGGGATTTCAATTGTCGACGGCATCATCCAAGTCTTGAAGAAGGCCCCGCTCGA
CGTGAGAGCAGCAATGCTGGAGAACCTGCTGCTTGTCGGAGGAACCGCTATGATTCCTGGTAAAATTACCGTTCGGGTAAAATGTTGGTATATTCCTTTG
CAGCCATGCTAACCTGTCTATGCTTCAGGCTTGGCGCAGCGTGTCATGGATGAAGTACGCGAGGCTCTACATCATGATAATGAGTTTGCTCGGCTTCGGC
TGCTGTTGACGAGCGCAGCTCGTTCAGACATACTTCCCGCGGAACATGCTTGCCTGGGTTGGCGGATCAGTATATGCTGCCACGGAGAGCGCTCGGCTCT
CGACTATTTCATCGCAAGAATACAGCAGCTCCAACGGCACCAGTATCCCTGACTGGCTCACTGTCGCTGAAGAGGGATTCTAAGTCGAAAGTGACTTTTG
CAGCGAGTATGTGCCAGTGACGGAGTACGTGCGGGATTTGAATGGTTAGTGTTTCCTATTGCCGAAATTGTTGAGCTATGAAGTGATTAACAAACCTTCG
TCAGCATGTATGGCACCATGGCTTCGTAAGCGAGACGGCTTTAATGTAGCATTTTAGCCGTCCGACTTACTTACTCGTTCGCATTCCGAGTGGCTTGCCA
GTGTCGTCCCATGGTGCCTTCATGCCAAGATCAGCATGTTTTTGAGATTGGTAGTCGCGGCTCCACTAGGCCGCTTCAACGGAGCGACGTGATGTGGCAG
TGCTGACTTGCGTGGTTGCATTCTCTCTCGCCACCTTTGCGTCTGCGTCTGCGACGATTTCACACCTTCCTCGCGTCGGTGTTCCTCCTTGGAATCGGCT
CGGAGTTGATCTTTGGTGCGTGATGTGATACAGTCGACTGCTGCGGCATCTTCCTCCTCGTCTTCGTCAACAAAATCGTTGTCGACCTTCCACAGACTGA
TGCGGCGTAGCTCTTTCACAGCCACGCACTCCATTGCGATACGTCTTGAGCTGGATACCTTCCTTCTGAAGAGAGACGTCTGGGAAATTGTGTCAAGTAG
CGGCTGCTCTTCCTCGCCATTTTCAAGGTAGACGTAGAAAGTGTAGTCATAGTATAGCAGCACAAGCACGACGCCTCCAATGTGGATCTTGCTCGCAATA
GCCTCCACATCCTATGCAGATCAAGCCCAGCAACGTTGAGTGAGTCGTGCAGTTAATGAAGCATGACACTACCAAAGTGAACTGACCTGGAATGCAGCGC
ATTTGCCCATGGCAATTTCAAAGAAGCACTCAACATTATCATCCTCAAGCCAGCTTCCAACGTTGCCCGGGCTCTTGACGAACGACCCCCCAGTTTGAGC
CAGTGTTTGCACGAATTGCTCTGCCTTGGACATCTCTTCCTGCATGGCAGGCACAATTCCTGCCAAGTGTTCCATCGACGGGGTAAATAATGATGTCGCT
GGCATCTTGGAGACTTCGCACATAAAGGTCTACGAAAAGCAAAATTGACACACGATGAGTAACACCGCGAGCAGAATGAAACTTGACCACTCGAACATTA
CCAGAGCACTTTGCTGTCGTCGAAGCATGGGGATGATGATAGGAATGTCTGACAACTCAAGCTTTGGTCCCAGATCCACGTGCCCGTTGTAGCACCAGTT
GCCAAATCGGAAGAGCACCTCGCGCAAACTCGGGGTGTTTGTGGAGCCTTCAGCACGAGGGGTGCGCCGAATGAGGAAGGTCTGGTTGTAACCTGTGCCA
CTGACATCTTTGCATTGCACTTTCAGTGGCTTCGGTGGGCTTTTGTGTTTTCCGATACTAGCCGCCTGCCACAGCGTGAGCTTTTTCATGTTGCTGCAGT
CGTCCTCACGGTATGTCTGCAAGTGGATGCCCTGAAGGTGAGCCGAGAGGTCCGGGAAACGCACATCGAGCAGAGGCTGCTCGCCGTCTGCTTCCTGCAG
CACGACGTAGAAACTACGTTGGTAGTAGATTACCAAGAGCACCAACCCACGCACAAAGGTCTTGCTGGCCACGATGTCCACATCATCGAAGCATTCATAG
CCACCGCTCTGCAACTCGAAAAAGGTCCTCGATCCACCATCGTCCAAATCGCCGTCCACCCACGTGTGCTCCTCTGCAGCTTTCATCAGCTTGCGTTCAA
TACGCTCGCTTGAAAGCTCAGCGCCGATGAAGTCGTAGACATCGTACAGCGTTTCAAGAGGTGTCGAGTATTGAGACGTTGAGGGCATGGCCTTCCACTC
GCAAATATATTGTAGCGAAGCTTGCTGCTTCTGTAGGGCAGGTACGACCACCGGCAGATCGGCGAGCTCCAGGTCGGCACTACCGAGATCGACCTTCCCG
CTGTAGCACCAATTGCCACAACGGAAGAGAACTTCATGAAGGTTGTTCTTGCTGGACCGGACGATGTACGTCTGGTTGTATCCGTCACGCAGTGCCACAA
TCTCCGGGGTCGGGGCTCCCGAGTCGTCCGCGTTGATATCGGCTTCGTCGGCCTGCGCCTTGGACAAAGGCTTGTGCATGGCCTGGGTTCGGTCGGCGTG
TCCTTGGCCTCCATCGTTGCGGCCTTCGCTGGTTCCCTAACTGAGCGAGAATGGAGGGACGCCAAGATCTTCGGTTGCGAAACTATCGTGGTCTCTAAAA
TGGGACGCACTTGCTGCATGTCAACTCGGAGCATGGCTCGAAACGAATGCAAAGTTTTGTTGTCGCATGTACGGATGATTATCTACACGGTGAAGCTAAG
CTGCAGTGCGCAGTCTGACTAGTATGTGCAATTGGCTGACGCTCTTTCAGTTGTGGCAAAGCTACCACTTGTGCTGCTGGGCCCACGCACCGGTCACCTT
CGGGCCCGCAGGTGCAGCAGCACTAGGTGCCGAGGGGGCAGCGGGCTGGGTAAGTGGCTTAGCCCACGCGTTTCCAGTCGACTGGGAAGACTGTGGGGCC
GGAGTGGGAACACCACCGGGCGGCGGGCCCCACGCAGCGCCAGGGGAGGAGGCGGCGCCTGGCGACGGACTTGCGGGTTTTGAACGCGTGCGTGGCGACC
ACGCATGATGGCCTGGATCTTGGTAGCTGCCTGCGCATCTGTCAACGGTAGAGCCTCCGGGAAGGCCGTGCCGATCTTCGTGTCCTTGCCCCGGCCGAAG
CTGAAGCACTTGATGTTGCACAGGTACGGGCCGAGCTGTACGTTGTTGTTCTCCTGGCCGTTCAGGTAACACATGGTGTACAGGGCCATCTCGAACTCCG
GGCTCACTCCGATCAAGCTGCAAAATGCCACCACATAGTCGTTGTTAGTCACGTTGAATGTAGAAACCTTGATTGCAGTAGCCAAGTTTCACCTCGTGGA
CACGGGCTTTATCTCGTCTTCCCACTGGAACTGGAACGTGATCAATTGCTCCTTGTTGTGGGGCTCCATAAACTTGCATCCGCGCTGCTTAGGGCGAATG
TATCCCCTGTAGTCGATGCGGCCGTTGCGCTCCTCGTTGTACACCTGGAGCCAATTGTGGCAACCGCACACTTTGCCCTGCTCGGCGAACAAATCCATTA
GCAACAAGACTAAATCCACTGATCAGATAAATCATCAATCTCACATTCTTCTCCTCGCCAACGAACACGTGCTCAAAGCCCGACGAGTCGTTGCGCACTT
CACGGCGGTACAGCCCGAACCAAATGAGCTCGAGCTTTTCTTGAAGTCCCCCATGTCGCCCGTGAACTTCTTGTTCTTGACCAGCCAACTGCAATTGACC
GCATACAGTCAGAACTACATCTACACCCTCACCGCCATCACCGCCATACTCACGCGTGGGCATAGCGCATGGGCGCCGTCTCAAGCACAGCGTTCAGGAA
CGCGTTGTTCTCCGCCAACTCCTTGGGCGTCACGCGCTCCGTCACACCTGTCTGTGTATCACAAGGAGCCAATTACCACATAACTCCAGTCACGACTCCA
CTCTGTTCATTGCACTCTCCAAACTGGTCGCACCTCGCGCTCGTAGTTGTCCAGCAGGTCGAAGAGCAGCTTGTACGTGCGGCGCTCGAAAACGCTCGGG
TCCACGAACGTGAAGAGCGGCTCGCGCGCCGCGTCACCGCGGGCGTAGGAGGTCTTGCCCTCCTGTAGGTTCACTTCGTAGTGCACGTTGGGCTCCAGAC
GGTTGGTGTCCAGCTCCCAGAGCTTGTTGCACGCGGCCGAGAGGCTCTTGAGCTCGGCGACTGCAACGGCACAAGTCAGCATTATATAGGATTTCTCAGC
CAATTCATTGCAATTCGCCTACAGTCGGAGTGGCGTTGGCCATGATGCAGGGGCTAGCGACTATCAGCGGCTCGAGGCGATCGGGGAATGAATTGCATCC
GTCCTGCAGCTGGATCGAGCGCACCCACACGCTGTCGTCAGTTGCTGGAACGAATGATACATGTACACACGACTGCAACCAGCGAATCAGCGTCGATAAA
ACAGCTGCTGCCACAAGACAAGAAATATGCCAGCCAATCAGTGTCGTCACAACGACAGCTGTATATACTTGTGTACCCGCAAGATACTCGCCAAGATACC
TTTTGCTTTCATGCCTTGCTCGTTGCTGAGCCCAGTTTTCCTCGGCAGACTAAGAGCAGGTCTCAGACTCACGCACTCTTATCTGCAGCATCCAAATTGT
TAATTGGCAAGCTGAGTGTCTTGGTTGTTCCGCTCAACGCGAGCTATCTCACCGTGAAGCGGGACGTGCAGCTCAAACTCAAAACTCAAACACGGCATCG
CAGATACCACGCCTCGATATAATCGGTAATCGGTGGCATGCAGGCGACAACACGGCCCTGGTTTGACTATCAAGCAATGCATGAGATTCGACCCCGCCTC
CACAGTAACGCACTGAGGATACACGTGGAGCGATGGAATTAGCCGCCGATGCGATCGCGCAGCGATTGACACGGGAGCGTCTAAGGCATCCCGTTTAACA
AGCCGCTAGCGGCAATGACTTGTGCTTGCAGCAATATCTACAAGAAAGCCTTGTACATGCTCGACTTATAAGTGATGGCGCGCAGCGTTGCCTTGCAAAG
CACGCCTGATGGCTCGAGAAGCACTGAGGGCCACGAGCAAAATGCCGAGCGCACCAGAAACGGATGTCCGTACCTTTGTAACGAAGGCTTCAACACTCTC
TTGTCCGATAACCTGGCCTCCAGAATCTTCAGTTTGGCTGCATCCGAGCCAGACACACTCATCTTACATCATTTAACTTCGCTCTTTCATCATTTTCAGC
ATCGTTGGTGGTTTTGCTAGGCCAGCCTCGATGATGTGCTTGGCCTTGCTTGGCGCCGCTCACCCGCCACTCTCGCACTCGCCTCGCCGCGCCCAGAGCT
CCGTCGTCTCCTGCCTCGCCCCAGCAGCTCCATGTGGCTCCGTCCCGGCGTCCTGCACACGCGCAGACTGCTCTTCTCGTCCGCGTGCGGTCGCTCGCGC
TCGTCTCTGGGCAGTCTGCGCGTCTTCACATCCGCCCGGGGGGCGTTGCAGGCTGCCGCAGCGCCGACTGCCCCGTCTCGGAGCCCCTGAGCGGCGGGTA
CCCCACGACCGCAGGTATGAAGCCGCCCGTGGACGACCAGCACGCCGTCATCGCCGACTTCATGCCCATCGTGCCGCCCGAGTGTCTGCGCGTGCAGCAG
GCCGAGCAGACGGCGCGTGGCGCCACCGTGGGCCCGTCCTCCTTCACGTCCATGTTCCGCGACATGTCGCCCTACATCAACTTCCACCGGGGCACGACCA
TGGTCATCCACCTGCCCGGCCAACTGGTCGAGTCCAACCTCTTCGGCGCCGTGATGCACGACATCGCGCTGCTCAACACCTTTGGCATCAAGTTGGTGCT
GGTGGCGGGCTCGCGGCCGCAGCTGAACAGGCAGTTGTCGCTTCGCAAGCTTTCGCAGAGATTCGACTGCGGCATGCGCATTACGGGACCCATGGAGCTT
CAGTGTGCCATGGACGCAGCCGGCTCCGTGCGCTTCCAGATCGAGAGCTACTTGGGACGAGGAATTGTCAACTCGCCCGGACGAGCGAGGACGATCAATA
TTTCTTCCGGGAACTTCATCACTGCGCAGCCTGTTGGCGTTCGAGGAGGTGTCGACTTCAAGAACACAGGAGAGATGCGACGACTGAACGTCGATAAGGT
GCGCACTGCACTGGATGGCGGAGACATTGTGCTCATCTCCAGCATCGGCTACAGTGCCAGTGGTGAGGTTTTCAACTGCCTCTCAGAGCAGGTGGCGAGC
AAGTGTGCCATCCAGCTCGAAAGTGCCAAGCTTATCTTCATGCATAACGGCGAGGAGCTCATCGACTCGCGATCCAACTCCATGGTGCAGACTCTTGTGA
TTGAACAAGCGCAGCAGTATGTCGAGTTGGCGCGCCAGAACACGGACATTAGCGGCGATTTCCTGCTGTACTTAAAGGAGTCTATCAAGGCCTGTGTGAA
CGGAGTCAAGCGCTCACATCTTGTCAGCCGACACGTGGACGGCGGCTTGCTGCAGGAGCTCTTCACCCGCGACGGCGAAGGTCTTATGATTACAAAGCAC
ATGTACGAAGGCATTCGGATGGCCTCTACCAACGACATTGTGAGCGTCATGCGCCTCATCCAGCCTTTGCTGGACGACGACGTGCTGGTGTCGCGTGATC
AGGAGCAGATTGAGAGCAACGTGGACACGTTCACGGTTGTGGAGCGCGACGGTGCGATCATCGCTTGCTGCACACTGCAGCCGTACGAGAACAACTTCGC
CGAGATGGATGCGTAGCCGTCGACCCGACCTACCGCAACCTCGGCAAGGGCAATGCTTTGCTAGGATATATTATGCGCAAGGCAGCAGCCATGGGCGTCA
CCAAGCTGTTCGTGATGACGACCCGAACAGCCCACTGGTTCCTGGAGCGCGGCTTCGTGGAGGCTACAGTGAACGATCTGCCTCCGTCGAAGCTGGCCAA
GATCGACCTCAAGCGCAAGTCGAAGGTCTACATTTGCGACATCAGCACGAAGAAAGCTCTGGACGAGAAGGAGCTGCTGCTTCAGATGGAATAACTCGGT
GCGCTGCCAATTTTACGCTCGACCGACTTTTTGCCTATCGGTCGGCACCGCGATTCCTTAGAGCGGATGCAGGAAAGCGAGCAAGCCAGTCATATTTAAC
TCACAGAAAGCTGCTCGGACATTTTCCCTCCCAGTCGTTCCCATGACTTCCATCTATCTGTTGACTGACGCTACTTGGCAAGGCCGTCTCGCGTTTGGCA
GGCATAGCCTGTGTAGCCTTGAAAGCAGGTGCAGGTTCCCGCCTTGTAGTTACACACACCGCGGTTGGAGCATTCTACGAGGCACTTATTCCCTGCAGCG
CCAACGGCAGTGCCGCCAGGAACAGTCTTTCCCTGGCAGTTGGTTTCGTCTACAGTTGTGTCCGGGTCGTCTCCGATGGGGCAGTGTCCTGTTGAAGTTG
ACACCAAGTTGAAGTCAAGCTGAAAGTCAGATGAGTGCAGGTCTTTGAGCAATCGTACGTTTCGAGCAGTCCGCGCTGAAATACTCCGTGGCTTGCAGCT
CGCCGCTCGCCGCCCCGACAGCCCAACCAGAGTCGCAGACACACCCAAAAATCCTATCGGCGTCCCAGGTCGCGGAGAACTGCAGGCGACAGACAAAATG
GTCAAGGTCGTGCTCCAGATAGCAAGTTTTGCTAACGGACGTACCGGTTGGCCTCCATAGGTTGTTGCCGCAGAAATGGGCAGTGCGTTTTTGGCGGCGG
CCATTTCGCGCATACTCATGCAAGTGCCTCGGTCTGAGCAATCGTTTGGGCAGCCCACTACATGCACACAGCAACAGGCGACAGTGGCGGTGAGCAAAAT
CGAAGTCTCACAACAACGAAACACGTACTTCTCTCGCATGCGGAGCCTTCAATGCCAGGAAAGCACATGCAGGTCCCAGTGCTTCGGTCGCAGATTCCCA
TGCCTGAGCATTCTACTAGGATGTCATGGGCAGTGACAGTGTCCGTGGGAATGGAGCTCCACGCGTAGTTCGATGGGCATACACCTGCATACATGGACGC
CAGGTTAAAATGTCGACCTCGTCGGCACGAATCTGCTTCACATACTTACGCGTAGAGCAGTCTGGTGATTTGTAGTCTGCAACGTCCGTCGGCGCACCCC
ATCCAGTGCCACAAATGCACACTTTTGATAGCAGCGTGCAAGTACCATGACCACTGCAGTCGTTTACGTACGTGCAACCTTCACCACCGATGGTGCTGCT
CTCTTCGATGGTATTGCCGCCCGCATCTCGAGTGCGCACAACAAAGTTCCCAACGGCCGAGTTAGGAGGTGTGGTGATCTGGTCGACTGTAAATGAGAGA
CCAGTGCTGGGCAAGATATTCGTGCCTGCAATCTTCAGTTTCACTGAGCTCGATGTCGCAGTGAGCACGGAGCTGGCAATCGGAATCCCAACCAACGAGC
CTGCGACGAGCGTGGCAGCCCCGACACTGTAGCCATCAGGAAGCACAGCCTCAATGTAGCCGCCAAGAGGGATGGTCGCGACGGTGTCTACTGCCACAGT
CGCTACTGTGAGTGTATCGGGGGACCTGAGTAGCGGACGCACGCGGCCGTAAGTAAGCGGCTTCTTGACGATTGGTGTACCGGGTATTGTCGTTAACTGC
TCGAACAAGTTGCCCCCACTGTCGGTGATAGTCACAGTGTACGTCTCCCACGTCATCGCGCAGTATTCCACGATGAATTGGTCGCACGAAGTTCCGGGAT
TCGTAATGCCCTCCACAGTAAATCCGCGGCCAGTTCCTGGGACTACAGCAGTGTTTCCTGTTATCATTCGTGTCTTGGTTGAACTCACCGACCCGAAAAC
AGTGTTCACTGTGGGTAGGTTCGTGGTATGACTGAAAGTTACGGCGCTAACGTCGTACCGGGCCGGAAACGTAACATCAACTCGACTACCTGACGGCAAG
TAGGCCGAGTTGGCAAACGCAACAGTGTAATCCGTGACAATACCGGCCCAGTAAGATATGGGTGTCACCGTCGCCGATGGAAGCGTTGCGCTCGTGTAGG
TGAGCCCAGCCACTGCCTGGTTTTCCTGGAATATGGCCCCGGTAGGGTGCCGTGTGTGAACTCCAAAAACTCCCGAGGCTTGAGCCGCCGGATTGATAAT
ATTGCCATACGTGATCGACACGCTCGTTCCGGCAGCAACGTCTTGGCCAGCAATTGTAAGGCGGATATAAGGCGAAGCCACTTGCACTATCGTCGAGGCT
ACAGCAATGCCTCCCAGACTGGACAGTGTCGCGCCCGTGAAGACAATTGTGCTGGCACTGAGAAGCGGGAACTGCAGTGCAATCACGCTCCCAACGCGTA
GTGTGATGCTCGTCGTGAAGGAGATACTGTACGCTGTCGTCGTGCCGGCTACCAGGTGATGCCGCTGTCACTACCGGGCTGGAAATCGTTCCTAGAGTGA
TCATCGATCCCGGTACAGTAGCTGACTCGAGGGTCGAACCGCTTGCACTTTGCGTGCGTATCAAATACGTGGAGGTTGTGCCCGAGCCTGTAGTGCCTGT
AGCCAAGTTGGTTTTACATCCTATTAGTCTTCGCAGCTCAAAAACCTCCGTGTGTCATTCGTTTTACCTGGATTCGAGATACCGTCGAGAGTGAAGGCGA
TCGGTCCAGCAGTAGCGTCCGTACCGGCCACCGCGATCGTGACTTGTGCGCTGGCAGGTGTTGCTACCATTGAACTGCTCAAGTCCAATCCCGAGGTGAT
CGTGAGCGTCGTGGAGGCTACGTAGAAAGTGGAGGGGAACATGACCGTGATCGTTCCGCCGACAGGGACGGTAGTGCCTGTCGTAAAGGCCACGCCCACA
TTACCCGTGACGCCAGCGACAAGAGACGCAGGTGTGATGGTCGCAGGCGCGATGGCTGCATATCCTCGCTCTGCGCATGACAGCCACAGCAGCAATTGCA
GCCACCACATCGCATCCACCCTTTCAAG