Description :
From Genome Similarity Track
Location :
contig_47:334044- 339036
Transcript NameFunction/comments
g7888.t1hypothetical protein

Sequence
4992 bases(100 bases per row)
TAGTTGCAGCTCGTACCACATGCGCACTGCAAACGCTTGTTTTACAATAGGATTGCTATTGGGGGTTCGATTATCCCCACCATCAGCTCGTAGATACACG
TTAGTCGGCATGCAGCGGCGCTGGACGACGCCGAGCTGGGGTTATGCCGTCGTGAAGCCCGTGAGGTCCGTGTCCAGCGTCGCGTACAGCATACTCTTCA
ACTCCTTCTTGCTGTGGTACAGCGGCAGATCCAGACGATTGAAGCATGCGTGACTCGAGATGTACTGCGTCGAGCGGTAGGGCACACCCTTGAGGTTGAA
CGGGCACAGGCGACCATCGTAGCTGGTAAGACCCCGGAAACCCGACAGAGGGACACAGGCAGATCCTGTCGCGAACAGCAGCAGGCGTCGACGGTACTCG
TTCGGCATTTGGCGAACAATCTCCCAGAACCAGCGAGTTACGCTGACGCCCTCAAGGTTAGGAGACAATACGGTGTGAGTCTCCCAGTCCGTTACGTCCA
CTTCGGGGATCCACACAGCAAGTAGTCGAATTCTTCTGGGTCAAAAATCAAAAGCATCTCGCGAGGAATAACCTCGTACAGACCCTTCAGGAATGCATGC
AGTTGGTCCGCCACACTCTCGAAGAGCACGTAGCGGAAACGCCGGTCCAGGTACTCGCGCTTGTTGGCATCCGTGACAGCAATATCCCGTCCATTGGGGA
TAAGATCCACCACGATTTTCTCGGTTTCGTTTACCTGCTCGGTTAGACTAAAGTCAAGTCCGAGGTCGTCCACGCCGTCGTTGTCCATCAGCCATCGGAG
ACTGCGGTACGCCTCTGGGTCGAGATACTCCATGTCGGCAAACGTCACTGGCATACCCAAGATCACCTTCAGCAACGGCAGTGCGAGATGAAAGCCCCAG
ATGCCGCCTTCCAGCAGAGCCCGACCAATCAGTCGACCTGTGGCAAAATAGTAAGCTAGGTGGTCCTCGCCTACCTCAGACCGGGATTGCGGATTGAGAA
AGTAGCTCTGGTCGGCCTTGTTGGTGCATGTAAAGAGTCGAAGCGTCGGCGAAGCCAGCAGCTCGTTCACCAGCATAAACCATTCGCGGTGCACCCCGCC
AGCATCCACGCCGCTTTCATCCAGGAAATTGATGCGCATGAAGGAGCGCAAGTTCTTCGGCTGAATGCAGTACATGTGGTCCATCGACTCTTCCAGCATG
TACTCGCGGTGGACAGACAACTTCAAAAACTCCACTTCTGCAGGCACGATCAGCGAGGCCGTGCTGACCACAAAGTGCGCGTACTTTGAAGGAAAGTCGC
TAGTCGCCAAAGAAACAACCTCCTTGCGTCGCTCAGCCCAGCATCGGCGAGCGTCGACTTCCCGGTCGCGAAGTCAGCCGGGTCCGAGACGCTCGCCTCC
ACCAGCTCCAGCTCCACGTCCGTCGGCAGCATGGGCTTGTCGTCTGCATTTTCCTTCTCACTCTGCGGTTGCTCCACAGCCAGACTCGGCACTGGCTCCG
TCTCCGTCATGGTTTCCTGTTCCTCCTGCTCTTTCCTCTCCTGCTCTTGCTCTTCGGCCAGTTCCTGCTGTTCCACTTCCTCCGGGAGCTTGAAACTCAG
TGTATACCCCGGCAAGAGTGTGTCCACGTCGCTGTTCGCAGGCACGTGGCCTCCGCCTCCACTGCGGTACCAGAAGAGATTCCCTTCCACGTCCAATTTC
CTCGTCCACTCTCGTCGGCTGCGCGCACGCCGCTGCTGGCGACTCAGCGACGACATTTTCCTCGGACGTGGCGACAGCAGGTGGGTCGCGCTCATGGCCA
TGTTGATGGCTCCTCCTCTGCTGCTGCAAGTGTCCTCCGGCTTGAGCTGCTCGTCGTCGCTCTCGTCGTCGGCCGTGGCGAAGGACAGCGACGGCAGCTT
GTCGCCGCACAGCACGCAGTACTCGAAGCGCTTGAAGTTCTCGAACGCGCAGCTGGCGCACACGCTGTAGCCCGCCTCGGCTTCTCGCGTGGCAGCGTCG
ATTCGGTGGTCGACCGACTCGCCCGACAGCAGCGGCACCTCCATGTCCAGCAGGTGGCGGTTGCGACGACACGCCATGAGCCACACCACGAAGAAGATGA
TGCACAGCAGCAGCATGCCCACGCCCTGGTACAGCATCGACGCCTCCGTGGACCGCTCGTTGTCCATCGCGGCGAGTCTTCAAGTGCTGCGGTTCAAGTC
AGTCACACGCAGAATGACCTTCGCTGAGGGATCCGTATTTTTCACTTGGTTTCAGTATTGCTAAGTCGCGTTTATGCACACTAGATTACGGCGACGAATC
CCCTCGAAATAGTGACAATCCACTCACAGCGACATGTTGACGGGGCTTGCATGTTCCGTCACCGGTTTCCCCTAACGGCAATGTACCAACGTTGGTGCGC
ACCCGATGGCTCTGCTTCAAACCATGCGGTCAAGTCACTGGCTGCCGTTGTTCCTGCCAGCACTTGTGACGTCTGGATCGGCGATCCGACGCGTGCAATC
GGTCATTGGCCTCTTGGTCAATGGTCGGACATCTGCAGGCGACCTGCACTTGCATTCCGTGAGGAAAACAGGCCGTTGTGACAATGCATCTCCACTGTCC
TCCACGATGACGGCAAGACACGCCGCTCATAATTTGCAGTCGATATTTAGGTCTTTGGATACTCCACGCTGCCGACTTCCTACGCCGTCGTGAACCCGTA
CGTCTCGGTGTTGAGCGTAGCGTGTAGCACCTCCTTGAGCTCCGCTCGCGATGATGCCAACGGCACGTCCAACCGGTTGAAGCATGCGTGGCTTCGAATG
TAAGGGGAGTGCACGCCCTTCAACGTGAACGGGCAGATCTGACCGTCGTGGCTCGTCAGGTGTCGGAAGCCACCGATCGGGACTCGCGAGCACCCCGTTG
CAAACTGCAGCAGGCGACGCCGGCACTCCAGGTTCATGTCCCGCACCAGCTCCCAGAACCACCGAAGCACTCGCGTCCCCGTCAAGTTCTTGGAGCACCT
CGTGTGTGCCTCCCAGTCCGTAACGTCGATGGAGTCGCAACCGCATAGCACATAGTCGAACTCTTCCACGTCAAAGAGCATGAGGATCTGCCGCGGAATC
ACTTGGTACAAGCCTTTCAAAAACACGTACAGCTGGCTTGAAACGCTTTCTAGAAAATGGTAGTGGAGCCACCATTCTGCGAATTCGTGCTTGTTTTCAT
CGGTCACCGGGATCTCGCCACCGTTTGACACCAAATCCACCGTCACCATGGTTCCACTTGCATCTCTGCGCGTTGTCGTGAAATCTAGTCCGAGCGTCGC
GGCACCATCGTGTTCCAACATCCACAGAAGACTTTTGTACGTCACCGGATCCAAATCCCCGTAGTCGCGAAAAGTGAACGGAATACCGAGAATGAGCTTC
AATAGCGCTGGTGCAAAGTGGAAGCCCACCACTTCGCCCTCTAATAGCGCACGGCCAACAAGACGTCCAACTGCGAAAAAGTACGCTAGATGCTCCTCAC
CGATCGCCTGCCTCGAATTTACGTTGAAGAAATACGTCTGGGCCGCATGGTTCGTGCAGGTGAAAACCCCCAGAGACGGGTCAATAACCAGCTCCGTCAC
GAGCGCGAACCATTCGCGGTGCACCCCCCAGCATCTACAGCAGTCTCTGCAGCAAAATCAATTCGCACCACCGAATGGGTATCATTGTCATCCATACAGC
ACAAGTACTCCATGGACTCCTCGACAACGTGTTCACGACGAAGAAACAGCTTCAGCACTTCCAGTTGAGGTGGGACAATCAGCGTAGAAGTACAGGCCAC
AAAATGTGCGAACTTGGTTGGGAAGTCTTCTCTTGACAAATTGAGCAGGCCCTTGACGTCGACATTTCTGGACGAAGGTGGCCCCGTCGCGAATGCTAGT
GCGTCGGCTTCGTCGGCAGCCACAGTCTGTATTTTCATCAGCTTCGTTTCGTGTTCCAGCTTCCTAGTTACTGAACCAGGCTCTCCGTCCGGTATCACGT
CCACCTCAGTCTCCATCTCTCTGCCATCTTTGCCACCCCCTTCCTTGAACACAGCAACATATCCAGGATACTGGGAGCAGTTTTGAGACGCCTCCGCATT
CCGATACCAACAGGCCTTTCCGGTGCAGTCAAGCTTGCGTTGCCATTCTGTTCGACGCCTAGCACACATCACCATATAATAAAATAAGAAGTCAGCCTGC
GGATCAAAGCATACACAACAAAAGACCAACCAACAACGCACTTTGCCCGCACTTGTCGAGCGGTAAGAGGGCTTCTTGCCCGAGATCTCTCTGTCGGTGA
CAGCTTGAGCTTCTCCCCGCAAAGCACGCAGAACCTGAACCTCTGTGTGTTTGCGAATGCACACACTATGCATCGTACTGCCTCCTCCTCTGCGTCCCTG
CAAGCAACCGCCACCCCGTCTCAGTCAGCAGCGTGTCCTCAACACCCCAACCGACCTCCGTCAGCCCCCCATATCCTACGTACAACGTTGCAACATCAAT
GCGATGCTCTCCGGTCGCATCATCTCTGCAGAAGCCACATTATCACAGCGTCAACACCTCAAAATATAAAAAATAAAAAAACAACAACAACGAGGAATCC
GCCGCCTACCTGGCGATCAATGCCTGCTGCAACTCGCTGTAGCTGCGCTCGCGGTACTTGCGCTGCAGTTTGCGGAAGATGTAGGCGACGATAAGGTATA
GTGCCACCTGGGAGGCCACGATGAGCACCACGATCACGTCCGCCATCTTCGGAGCTTTTCGCCTTCTTCAAATTGAGCACAATCATTGATGTCGATGATA
GTCATTAATTCGAGGGGAACTCAACATCGATAGAGTCACTGAAGTGGTGCATACAACTATATCATGAGCGGCGCACTGAACGACAAGAGCGCGCTGGTGC
TGGAGCTGGGGGCACGTTACGCGCGATGCGGCATCTCTGGGGAGCGCGCGCCTCGCTGTATCGTGCGCTGGCAGGTGCGTTGTCACCGTATT