Description :
From Genome Similarity Track
Location :
Scaffold_97:33404- 38779
Sequence
5375 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTAGTAGTCCGTTCAACGACCATAAACATGTTGGACGATGAGGGGGATGATTTTCATCACACGCATTAAAGCTACTCCCA
TTTGAGTCAAATCGAATGGGACGCTGTCGAACGCTTGAGTTCAACGATAGGGCAAGACGCCGTTGGGGCACTGCTGTACGCCCTAGGGCCAGACGGACAG
CACGCCACCATCGCCAAGTTCATTCAGAATGAACTTGACGCCGAGCGGGAAAAAGTAACCTTGATTCACCAACAAGGTTCTCAACAGACAGAGCTGTTGA
GAGAACTTAGTGCTCAACAGATTGAACTGTTGAGACAGCAGCAGGCCACTGCTACCGGGTCGACGTATACACGTCGACTCGAGACTCTAAAGATCGACAT
CTCAAAGTACAAGGGAGCCGATGAAGACTCTCTGCTGAGATGGTTCGTGGAGCTAGACGATTCCATAAAGGCTCGCCACATCGTCGATGAGCAAGTGAAG
ATCGCATTTGCTCAATCGAACTTGGCAGGGTGTGAAAAGGCGTGGGCTTTGGGCCTTAACTTACACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTCA
AGTCCCTGCTTAGGCAAACTTATGAGCCACCGCGAGCTGAGTTCAGGGCTCGCTCTGAATTCCTGAGAATCAAGCAAGGAAAACGTGACGTACACTCGTA
CATTCAGTACATACTTCAACTTACCAGTTGCATAACAGTCTACCCACTGAACCAACAAACGTTGATTACGTTGTTCATGCACGGTCTGACTGATGGTCCT
GTTAAAACCTACCTGTTCCGATTGGACTTCAACACCCTAGAAGAGGCAATAAGGGTTGCGGAACAGGATCACTTCAGCGTGAAACAGGCTCACGCGAATT
CAAACTCCTATCGTCCGTCGAGACGAAAGGAAAATGGAGGTCCAGAACCAATGGACCTCTGTCACGCGAGGAGCGAGAGCTCTCGTGTTAATAACTACAA
GAAATTACAAAAATGTAATAGATGTCAGAAGACAGGGCATTATGCATATGAATGCAGTGCCCCGAGAGCGGTACCACGTACCGCAGGAAACAGTAACCGC
CAAGCGGCCAAACGAGGTGCAAGGCGTGGGTCCGATGTTGTTGCGATAACGCAACAACGTAACGGACGACCACAAAATGGCAGGGTCAGTAGGTGTGGAG
CACCCTACTGATACAGCAACGTCAAGTGAGTTTGCAGGCCTCTTGACGAAAGTTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTATTGGGG
AGACATTACCTTGAAACTCGAAGTGACACAAAGTATGTCGCTTCGAGCCATAGTCGATTGTGGGGCGTCGAACAACTTTGTACGATGCCAACCCCTAGAC
AACAGCGAGCTCAAATATATCGAGCACGAAATCCCTCCAACGAGGATGATGATGCGCCTCGCAACAGGCGCATCCGTGACAGTGATGAAACGTGTAGTGG
GTATTACCTATACACTAAAGGGAGTCCAATATAATGATTATTTCATCATATTGGACTTGGATGACAAATTTGATGTTATTCTTAGACTGCCGTGGCTCAG
AAGGTACTAGCCACAAGTCAGCTGGCATCGACGACCAGTCGATATGCCTGTCACTTGTTCACCGGATGGCCATCTGATGAGCGCCATGGAGTGCCCACTA
GCATGTGGGTGTACTACGAGCGAGTACGATGGCCTCGCGTGTGGTTCGGTCATTCGTACGACTGCACATGGCCATGACGTGGCTGATCGCCACACCATGG
CGCCAGATTCCGGCGACAGCATTGAGATGCAGGTCGCGCCGAAGGGCCACCACCCGAATAAGTCGAGTGGACTGGGGCATGGGTGTCCTCCTAACAGTCG
ACACCCAAGTGACAACGAACCGATTGCCAATGATTGGCAATACGATGATCTTAGTGCGAATGGAGAATCGCACGTAGAAGACCTGGCCGCGGTAGTGCAA
CCACCACCAGAAGATGGCGAGGGAGCAATTCCACTTGTGTCATGTGATGATTTATTCCAAGTGGCTAGTGAGGGAATAAGTCCCCACCTAACTGTGGAAA
GAAGTTCCCAGGAGATAACAGAGACATTAAATGTCCTGGTCAATGACGGATCGAGAATAGGCACTTAACAACTTAAACTGATCTCGCCTCCAAAGACAAC
TTCGGACATCATTCAATTGCCCAAGCTCGAACAGAAGAGGTTCTTGCGTGATCTGCGTAGTTGCAAAGTCAAGCAGATTTGCGTACTCATCGCGGAAGAC
GAGTACGTAACCGATATTCGGTCGGCAATGGTAATTGCTGAGAACGAAAGAGTTCTCAGCAGCTCATCAATGGACGAGAGTGTCCTTGATGAGAAGTCTT
GGATTGCTCGGATATTCATCCTAATCGTGGGATTCGCTCAAGACAAATCCTCTCTACGATGTTTTGTCGGAATTCAGAGATGTGTTCCCAGAAACAGTGC
CGTGGGAGCTACCCAAGAATAAGGGTACTCGTCACGAGATCTACATGAAACAGGTTCAAAATACTGCGTCATGAAGCAATGGCCATTGCCTCGTGAACAA
GTACTAGCGATTGACAAATTCTTTGCCGATCGCTTGGCAGCGGGCCATGTGAGAGAATCTACTTCCTCACATAGCTCTCCGACCTTCTTTGTCCAAAAGG
CCACAGGAGGATTGCGGATAGTACATGCCTTCACCAAGTTGAATGCTGCAACTGTACCGGATCAAACGCCGATACCAAGGAAGGATGTCATTATAGATGG
TATGGCAAGGAGTACCATCTTTTCCTCCATGGATCTGATGGACGGGTTCTATCAGATCCTTATGCGTGAAAAGGACATTGCGTACACAGCAGTGAGCACC
CCAAGTGGTATGATTTGGGAATGGTTAGTAATGTCACAAGGACTGAGTAATGCCCCTGCTACGTCCAACAGATGCGTTACGAATCTGTTGAGATCTGTGC
GAGAACTCGCACCTAGCTATTTTGATGACGTGTTCGTCCACAGCCGGTCTATGGATGGACAGACGGATGTGGAAGTACACCGACTCCACGTCCGAATGGT
TCTTACACTGATGCGTGCGCATAATTTATACTCCAACCTCAAGAAGTGTATATTGCTGCAAGCGAAATACCACTTCTTGGATGCGTAGTGGGTAAGCACG
GCGTCCGGCCCCATCCAGAAAAGATCAAGGCGATCACTGACTGGCCGTTGCCTACCGACATAAAAGGACTTAAAAAATTTCTTGGTCTAGCGGCGTATTT
GCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATTGAAATAGAACGAAAGTGGGCATGGAGTGCTGATTTCCAGCGCTCCT
TCGAAGGTATCAAGCAAGGCTTAATACGCTCGCCACTTTTGGCGATTGCTGACCAAGACAGATCGTCATGTGGTCTGCGATGTAAGTGATTTTGCCATCG
GATGTGCACTAATGTAGTATGACACAGACGGTGATGAGCGTGTCGTCTGCTATCATTCACGTCAGCTAAAATCGGCTGAGCGCAAGTACCCGGTCCATGA
CAAGGAACTCCTTGCCATGAAGTATGCTTTGACAAAGTTCAGGGTCTACCTGCTAGGCGATAGACCCTTCATCGTTTACACGGACCATGCATCCTTACGC
ACGGCCGTTAACAGTCCACAAATCTCGCAACGAATGGCGAGGTGGATGTCGTTCTTCGCGGAGTATAACTTCTCCGTGGAATATAAGTCAGGACGACTGA
ATGTCGTCGCTGATGCTCTGTCGCGCCGGAACCGGATGCGCAACCCGACACTGGTCCGACCACTGTCGCGGTGTTGACGTCGAGTGTCCCATCGTCAACC
TTATTCGAAGACATACGCAAGGCGTACGATACGGCGATGGTGCGCTTGGTGGACTATCTCTCGCAATCATCCCGTCAACCCTTAAAGGGTTACCCAAGTA
TATCGATCCTCCACGGATAGATATAGAGTCCACAATGGCTTACTGAAGTATTCAGCCGTTGCCGGCGACACGCCTCGTGTCGTCGTATCGGACCATGGTG
ACCTGCGACTGCGCATCATGTACAAGTACCACGATGCATCTACTGGTGGACATCGTGGTCGAGAGAAGACATATCTCACGGTTGGTCGCACTTTTACTGG
TCCCGCCAGTATCAGTTCGTGCGTAAGTACGTCCGCGCATGCATAGTATGTCAACGAGTGAAGTCTGGTCCTTCCCTTCGTGCGCCGTTGTAACCCTTGC
CCATTCCGGCGGAATGCTGGGAATCTGTCTCAATAGACTTTGTCTTTGGATTCCCCGCAGACCCACACAAGAATACCGGTATTCTCGTGTTCGTTGATAG
ATTCAGTAAAATGGTATATTTGGTCGCTGTACCTGAATCTATCAATGCATCGGCATGTGCTCGTGTTTTTATTGACACGATCTTTCGTCTTCATGGGTTG
CCTCGTGAACTCGTCTCCGACCGAGACCCACGGTTCACTGCTGAATTCTGGCAATCCGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGACCTCTT
ACCACCCTGAAACATATGGTCAGACAGAACGTGCCAACCGCGTTCTTGAGGAGATCCTTCGGGGTTACGTCCATTCGTTTACGAATTGGAGCGAATTCTT
GCCAATGGTGGAATTCGCCATCAACAACTCGGTACATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCTTGCGCCACCCACGCCTACCCACCTTT
TTAGAGTGTAACTATAGTTAGAGGGGGAAGAGGGAATCATTCGAACGAACGCCAACTTGGCTCTCACTCATCACGTACTGACCACGAGGTCACTACGTAT
GACGCCGATGTCGATCACATCGACTTCGGTGAAGAAAAGGAAGTAAGAGTGAGGGTGCTCTTACTACCCAGGTCACTGATCTTGCTGCAGTGCGCTCCAA
GCGCACTATAGCCAAAGACAGCAATTCAGCAGATGAATTCGTACTGGCTCGCGAAACGGTTGTCCGTTTCGGGCAAGATTTCATTGCAGAAGCAGTGGAC
CGACAAAAGAAAAACGCTGACAAAAATGGATGAGCATACCTTCTTTCATTCAATGAAGGTGACCTAGTCCTACTATCTACGATAAACTTACCTCGACACA
TAGTGACTAACGTGGGTAGCAACAAGTTACTACCCAATTTCATCGTCCCATTTCGTGTGCTGCGCCACATAGGCAACGCATACACAATTGAACTTCCACG
TAAGATGCGCACGCATCCTACGTTCTACGTCGGTCGCCTTAGGCCTTATCACCAGTACGGGGCTTCTTCCGATGA