Description :
From Genome Similarity Track
Location :
Scaffold_1765:3340- 7014
Transcript NameFunction/comments
Phypl_g14104hypothetical protein

Sequence
3674 bases(100 bases per row)
ACTTAAACCCCGAGTGGCGTTCCCCGAGAGACCAACTGAGACCCAGGAAATGCTCGAGGATGACGATTTTGATGCTGCGCTGTTGCGAAAGGATAGCTGG
GAACCGGACGAGAGTGCTAGAGAATACGAAGTGGAGACCACCCTGGACGTACGCTGGGTCACGAGGACCCGCACTAGTCGACGCGTTAAAGAATACAAGG
TCAAGTGGAAAGACTACGACGTCCCCGAGTGGATTCTCCAGGAACGCCTGAACTGTGGCCGATTGCTGTACGAGTTTGACCGAGGAGAACGTGCACGTGT
CCGTTTCCGAGTGATGCAGTCAAGCGAAGCGAGGTAAATTATTTGAAGGATCACATATTCGTCGGATCTATGTTTTGGAAATTTTGGAAGGTCGCAATCG
ATAGCTAAGACGCCCCTCTTTCCGCTGGTGTGCCTAAATCGCGATACGTACTTTGGTTGATAAGTATACTTAGGTAAGCCGCTGTATACTATAATAGAAT
GCATCGACATAGGTTATTCGGTACGGTACATGTTTACGATCCCTCGAGGTCATCATTGACTGTTTACGAGAAAAGCGGTGCTATGTACATATTGTAGCTC
CCCTACTACTACCGCAATCCCCCTGTCAGAAGCGTCGCTCTGTCAGTGGGTCACATCgcttttagccaatcatatgACAGGAAACGTACCGGTACACACG
ATATGCTCGTCATAACCATTCTGTCATATAGAAGAGCGAGACTATAATGTCTGCGCAACAGAGACCACTGCCATGAAAATTCGCGAGATAGTAGTTATTG
TGTGAGAGTAGGATGCCGACACTTTTGGTAGCCATACCCAGGGCTGTCGTCAAATACCAAATTAAGTACGAAACAATGCCGTGCCTAcgggaagctctgg
atttttGAGAAGTCGATATGTATTGTGCTAAATAACCACTTTTATTGTATTTTAGGTTTACAATATTGACGGAGTTATGATCATTTTCAGACTAATTTGA
TGCTTGTTAGTGCTGCTCCGTAGGCTGGCCAAACACAAGGTGCCGACCAAGACGCAAGGTATGTGTGTGTGCTCATCGCCGTAGAGGATAGCAGTGAGAT
TGAAGGAGTGGGCGTGAGAAGACGTTGATGGAGTCGGGCGAGATGGACTTTCTCAAGGATGGACCCGTGTTCTGGGTGGAGCTATTGGCACGGCCAGAGG
AATTACATGGACGCCAAAGGCTGCCGGGTAGCTGTTCCACAGTGTCCTGCCGAACTTGGGCATCAACGGAACGGAACTCGCAATGGACGCCATGGCCAAG
ATCCAGGTATTCTTCTACAACGAGTTCGGACCCGCGGACAAGGAAAAGAAGGAGTACAACTACTTGTGCCTACCCACCGTGCACCCAACGCGTACCAGTA
TTGACTCGACGGTCAACGGGCTCAACCAGATGTATTTCGGTATtttgtggtggtggtggtggtgaggTGCTGACGTGTGATTTTTGTGTTCACGGCCAAG
GTTGCTGATGACGTGCGCCTGTCTCCCTTCTGCGACATAAAGTAGGTTTGTTTGGAGTTACTTTCGCTGGTAGTTTTCAAGTGCAGCTAGCCTGCTTCCT
GTTTTCTCAAGGAATAAGCTTACTCCGCTACTAAAAGGGATGGAATTCTGTACACCGCTTAAATAGGATGACTTCCTCTACTATCTGTAGACATATTCAT
ACAAATTGCTgcgatggtggagcaggCGTCAGTCCATACCTGCTGCAAAAAGATAAATAGATcactcgtgcagcttgctATCACTCGATGATACAGGAGT
GAAGTAACTAATATCCGGTGTCGGAGTACAAGCACCCACGCTTCCATCTGAAAACCGCAACGGCAAGCTTGACCTGGTGTTCGACTAGTGCTACCACGAA
GGCATTGCCTGCTCGCTCGATTCGATTGGATAGAAGTACGTATTGAAAATATGTTATTCATACTCACTGAATTGGATGTCACGTGGCTTTCTTGTTAAAC
AGGACTCTGTATTCGCCGGTCAACGATGTTCTTGGAGAATCTCCATCAGTGGATGGTGAGATTTGTTTTTAAATTCATCGGGAGATAAGCTGTAGCAGTA
CTAACATGGCTCTACAACTTTACGTTGTAGCCTTCCTCTTGTTCGCGACACCAGAGCGGTGGCTTTGACATCATGCTCGTTGGTTTCGGCGACAACGAGT
ACTACCAGTCGGGCGACATGAAGGGTGCCATGAAGATCCTTGCGCTCACGATCGCCAACGCCGATGCTGCTTAGAAGTAACCGAGCAATATAAATGTGCA
ACGAGCACAGAACAACTGGTACGCACTGTCTGCATCAAGGACCTTGACTCAAGGCCAAGTAGCTGCGATGTGATAGCATTGACAGTAGTATTGACTGTGT
TTATATGAAATGTGAAAATGAAGGCAAGTTTAACCGCGTGTGAAATGAGAAATGATGAACGCAATCCGCGCCGTTTGGCTCAAGAGGCTTctgggtacat
ctccgaaggGCCGGCGCAACCggatcttccttctctcggacgcgaaNNNNNNNNNNGCCCCTCGCGTTCCCGTTCAAGCATCAACGCACAGAGGAATTGG
GATCCTCTGTGCTCATGCTTCCCCTCCCCAGGCTGCAACACAACAGTCCATATCGCAACGGTTCCGACATCCCTACATTTTCCGACAGTTGGGACGGCCG
TAAAAAACGTGCAAAAAACCCGGTTGCGGCCAAAATACAAACCAGTATCTTAAGGTTAGGTATTTCTATCGATTGGCCTGCATGTCTGCTTCAGCATTCA
TGGGGCGCTCAAAGGCGCGAGGAAATCGGCTCTAGCGGCCTCTGAGCCGAGAAAAACGACCTTTTCGATATGCATGTTTTTTTGGCCCCAGAGCAATGTG
AACCGGAGCCGGCAATTTCATTAATGAGGGCGGAAGCCCAGCTGAGGGGACCACAATTtagagcagcagccagcaagcCGCCGTCGAGGCTCCCCATTGG
TAGATATAACAACCAATAGAGCACTGATAAGGAATGAGTAACCGTCGATCCGCTCCCTTATTGGTTCTTACATCATCAAATAGGAGCCTGCCACATGACT
GTGAATAGACACACGAGTTTGTGGCTGAGATGGATTTGCGCTCGCCGACAGAGCCGTAACCACGCTCAGTCTTCATTTTCTAAGAGCTGCCACCCAGACC
TCGGGACCCAAGACCAGTGGGAGCGCGTACAGCGTGTACAGCCCACCTCTGACCcggaccccccccccccagcaCCGTAGCTCAACTGGCTAGAGCGTAG
GGCTTCGGCCCTGAGATATCTGTTCAAATCAGGCCGGTGCTATTGATCCAGACGGGGTTGGCGGCAGTGCGTTcctgtgtgtgtgtgcgcGCGTCTGTGT
CTGTGCGTCGTCTGGTGTTGTGCTGTGTGTACGtccaggtgctgcgcgtgctgcgtgtgctgcgcgtgctgtgtACCGTGTGTCGTGTGCCGTGTGCGTG
CAGGGCTGTGTGGGTGTGTGCATTTCGACTAGTGCTGCTACGTGTTGCTGGTTACATCAATATGTAATATGTATTTTTCTATGCGCCTACTAACTCGTGT
AAACGTGGCCTGCAGTGACTAGAATGTCTTGGGTGTCTGCAGGAGCCGGGTCCTGGATGCGTCCGATGGCAAGC