Description :
From Genome Similarity Track
Location :
Scaffold_1618:3340- 5225
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1618-snap-gene-0.3Cleavage induced predicted protein
Pytiw_DAOMBR242034maker-piw_contig_1618-snap-gene-0.4Putative tyrosine recombinase

Sequence
1885 bases(100 bases per row)
TGCGCTCGAAACAGTGTACCACGCGCCACGACCTCCAGCGTCTACTTGGCAGCCTTCGGCACATCTGCTCGTGTATAATATCTGCAAAGCCGTTCTTCCA
GAGCCTGCAAGCGGTTTGTGTCAAAACTTCAAAGTACGGCCGCGTGTCGCTCGTGGGGGGAGACCCAGACCGACCTGCAATGGCTCGCTCGCATTCTGGT
CCACGGACGCCTGCAAATGCTGCCGACATTGATGCCCTGTCCGTTAGTGGGCATTGACGTGCACCTGTACATGGACGCCAGCGACAGCGGTTTGGCGGTG
CTCAACCCGGCCACAAAATCATTTATCCAAGTCCAGTTCAACGAAGAAGAGCGCACAATGATCCAGGGAGACACAGGATCAACTGGATTCAACATCAACG
CACGCGAATTATTTAGCGTCGCGCTAGCTGCACTCCTGTTCGGCCCCACCTGGGCTCCCGCATCAGCGAATTCAGTCACACACGTCAAAGTTTGGATCGA
CAACACCAGCGCTGTATTGTGGACCAACAAGCTCGCGAGTTCAAACCCATTCGCGCAAAAAGTGATCCGAGCGATCGGATTGGCCGAGGTCACGGATTCG
CATCTCGATTGCCCACCTGGCTGGCTTCAGAAACACCATGGCGGACGCAGGGCCACGCAACTGGACGGAACCGCATCGCTCACTCTGGACTAATTTGTCT
CGTGGTTGGACGCAGGTATCTATACCAGTCGCGACGCGAAAGGTCTACTCGACATTCGACAACTTACAGTCCAGAGCGTTGGCCAGAAGCTCCAAGCAGA
AGTACAACGCAACATGGCGACAGTGGGCGCAGTGGTGTGACCAGCTGGGAGTCTCGCCGTGGCTTTCCAACAAACCTACAAGAGTAGTCTCTGCAGCTCG
CACTGTTTGCTGTCGACTGCTGGGAGCAGCGAAAACACGGCAGGTCGAACGCATATGATACCATTCTGCCCAAGACTAGCCACATCGGCTGGCATCATAA
GCGCCGATACGGATACACCGTCGGCCTCCATAAAGGTCCCAAGCTCGTACTCCGAGGGATGCGTCGGATGTTGGAGCCACCGCAGCGCATATCACCAGTC
ACGCGACGCCTTCTCAACAAGATGCGCAACGGTGCAACTTCAGCAAAGCCCACGACCGCGTTCTCTGGGGAGAGAGGGGGGGGGCTTCTTCTTTCTTTTC
CGAAGGTCAGACTACCAGAGCGACAACAATCAAGTCAAGTACTACATCATTCGACAAAAGACATATAATTTATCACGAAAGACGGCCGCCAATCACAAAC
GGTGAAGCAAGTAGCAGCAGCCCAAATCTTCTTTTGAGGTAGCAAGACGGATCAGTTCAAGGTCGGTGAGACGAGGATCCTTGAGTGATTGAGTTCGAGC
AGACTATGTCCACTTCTGGCTGTGTGGTCCCTTGTTGAGCACGGGGGACTCTCCAGAATTCCAGACGACCAACCCGCCTGCTTTGTTCAGCCTGGGCAAT
TGATCGAGGTGGCTGAGATCGCGCAGCTCATCGAGTCAGCAACTGCGGCCATCGGTCATGACCCGAATCGATTCAGTACTCATTCGATGCGTAGCGGCGG
GGCCACAGCAATGTTCGCGGCCGGGATTGATCGCCTCACCATCAAGTTGTTCGGCAGGTGGCGGTCAGATAGCTACGAACGATACACACAACTCGACGGA
CAGACGCTGGCGCAGCTCGCGGCGAAGATGATCGGCAACAGCACCTCGTCAGAATGAGCGACTATGTCTGGCTTCGCCAGTGGGGCTACTTCCACGCCAC
ACCCGGCTGGAGGCACGTAATCGCTCAATCAACAACTCGAGTGCGGCCCCATGGTTGGCAGGCGCGCGGGGGAAAACGGGCGCGG