Description :
From Genome Similarity Track
Location :
Scaffold_642:334- 9742
Transcript NameFunction/comments
Phyag_g7220hypothetical protein
Phyag_g7221hypothetical protein PHYSODRAFT_469149

Sequence
9408 bases(100 bases per row)
TATGGAGGGGTCATTGCTTGCAGGAGAGATTGAGCCAACTCGCTTACCACAGGTGAAACTTGACGATTGCGTACTGTGATCAAACATCTATGACATCATG
ATCAGAGTACTCGTTAGTCCCTGCAACCAACTGTCAGCGCTGAGGTTCACCATACCTGTCGATGAGTCGCTGGAGTTCTGCTGGTGGTAATGTACCAACG
AAATCAGGAAGCTTCCCAATGAGGGCTCCTACCACTTTTAGGCCGTTCATGGTAACAGCTTCATTTCGTGTAGACTCGAGACGGGTTGTCGTGGCCTCGA
AACACTTGCGAACAAGTTGAAGATCGCCGTTGTCTTCCATCGAAATCATTGCGCTACCTTTGTACAAGAGTGAAAAAATGATCTAGAGCAAGAAAATGTC
ACACGGTGTGTTAGTTTGCAATGACCGCCAGAAAGTAATATCTACCTGTAGGCCTCCGGCAGCTATGTCTTCTTCGAGGCAATTCTCAGTTGATAAAGCA
ACGCGTGAAATGAACCCCTCTATTTTCCAGGTTCTGAGAACGCTGATCTCCGATCGTGCAATGGCACTGCAACATACGAACCAAGGCATGTCAAGAGAAA
TAAGTATATGTTCAAGGGTTGGCTGGAGCACACGAAACAGTAATAATCCCACCTGAGTAAAACATTGCAACAGCAAATGCGAACTTGCAGCGGTAACTCG
TGATGTCGAGCTTCACTCCACATATCCTTGAGTAATTTCTGCACTCTTAGTCCGAGGTTGTCACCGTCACCGTCCTTAACGGTGTCTTCCTCATTTTCAG
CACCGAATATCCAGGCCAACAAAGCATTCATCATTGATGAAGCTCGTgttgtcgacttcttcatgcCATCTTGGCTGTCCTCTGAAAGTCTTGACAGAAT
CAACGCGACGCAGTCAATACAACCACGCTGGAGATCGGTAAGGAGCGAATCATCGCCTTCAGTAATTGGGATTCCCAGAATTTGTATCAGCATGACAAAT
GCTCTTGAAGTGATGTCGTCGCTTTTATAAATATGATCGTCCTCAGAAAACACTCGGTTGAGGTAGTAGACCATTAGCTTGGCCGTCACCAATCCACACG
AATTAGGAATGCTTTCCTCATTCACAATACACGAGCTATCTCGTTTGTCGTGTGTGCTTGTTTCTTGCAAGAAGGCAACCAAGTACGCGAGCACGAATGG
TAGCACAGCAGGAGACGGAAGTTTGGCTAGGCACTCCGTAGCAAgcatcttcacctccttgAATTCCAGAGGATCTACCACCGAGCGGGCAAGAATGTGA
AATAggatgctggtggtggtatcTGTATCATTCTCGAGAGTTGTCTCGGGATCGATTTGAGCAGACTGTAAGTGGCGGTCGACATAGTCGTTTAGGTGAT
CCAAATCTTCGCGTCCACACTATTCCACATACACAATGCAACCAGAAGTCAGCAAACTGGTAAAAAGGAAGCAATCAAGGTCGACACTAAGTACCAAAAC
TGGCGTTATACGCTTAGATCCAAAGCCGCCTCGAGGTAGCATTCGTAGCACCAATAGCGGTGCTAGCCGAGAAAATAGCAGTCCCTCGATAGCTTTTGCG
GCGGTGGATGAATTGTCGTCCAGAAATTCTTCACTCAAGCGTGGCAGGTTCTACGTCAGCCATATCATCACACGATTAGTGTTACGGATAAAAGTAAGTA
TAGTAGCACACTTACCATCATGTGAGCGCAtagctgcttctccacattTTCAAACACTTCGCGGTCCACCCAACCACACCCCACAAGCTCACGCAGCATC
CGCAGTAGTTGCGTGTCACGAGGGAAGTGAAAGATTTTGTGAAGCAAAACGTGCAATATTTCACTGCGAATCTTGGCTGGTTGAACGTATTTGCTCCATC
TGGGCGTCCGCAATATGAAACAATACGTCATTAGAGAGAAAGCCGAAGGCTCCGTCACTAAGTGATATTATAACGTACCCACTTGGACCGCAGCAAAGTG
AGAGTAACTTTTCTTGCACTTCTTTTCGTTTGACGTCATCAGCGATGTTTCCTTTGACGCCTCCTCCCTGTTGGGTAGCATAGCCGTTCCATTCGCACGG
AGAGACCGGCGCCCTACTAGAAATCGAATGGGCTTGGACGCTCCCAATCTGGTAAGCGCCAACAAACCACGACGCCATCATTTCAAGAAAATATTGCGTC
GAAATGTTGAAGAGATAGCCGATCACCAACGAGAATATGTGATTGTCGGGGTCTTCAATGCCAGTTGCGCACAACCCAGCGATGGAGGACGCACGGTCCA
GTGATGGCAAACACGCAAGAGACTACGCCCAAAACGAAACGCGTTAGTTATTCTGCAAGAACACGAATTCAATGGCACATGTTGAACTTACTAATCGGTG
AACACGATAGTTTTGATGGCCAATGAGACCTAGCACTCCTGGTGTAAGCTGCTTCCTGGCGAACCAACACAATTTCGTAAGCTAAACGTTCACTTATCAA
AAGTAGGGAATAAAGCTTCTCTCTCACCGCCAGTGCCGGTTGATCGTCGATTGAGTAGCTGCTCTATCCAGCTGGTACAAGAATGTCCGCACAAGCGAGA
TAGCGCTCTATGTAGCATACGGCAAGGCAAAATATCAGCACAACTACAAGATTGGGTACGTTGAATCCATTTTGCTCACCAGAGCAACTTGTGTTCGGGC
GTCTTGTACGCGTTGTACAAACTCCGTGATAAATAGGCCTCGAGAAATGACGAAGTCTGACACAAACAACTCCAGTTCTGTTTGACTGCGCGACCCACTA
CAAAAGGTTTCATGCATATTGCAATGTGTGTTCAGCAGCTGCGAAATAAATGTTTGCGCTTCGTCTTGAGTGCTCATGAGGCAGAGCGTGTCTTGAGGCA
AAAGGATTGCTCTTAGAACTTTCAAAACGAGGAGCAGTGTTGCCTCATCAGCATTCTTGGTTGACACAGACAACCCTTGGACAAAGAAAAAAATGAAGTA
TGCCTTCGTTTCTGCTGAAAACCCACCAAAAGCCTTGGAGCATCCTTTAATGCCACCAATTAAATCCATCAAAACGCATATGTATCGAACTTGAGCATAC
ACCAGCTCAGGGTTTTCCATCGCTATGTTGAACCCAGTCTTCTTCTCAATGTCAAATGTCCACTTCTTCAAAACACGAACCAGAACTTCCGACGGATGGC
TCTTATGAATTCGAGAAGAGGCGTCACTGCGTGTGCAAAGCAGTGGGGCGACCACCTCCCAGTGCCAACATAACACATCTAGTGCTGCTACAACTTTTAA
ATCTTGGTCGCAAGAATGTTCACTTCCAGGTCGAGCCAAAACGGAATCACACGCTGACACATACGACTGCATATGTTGAAGCACGAAGCCGAGGAACTGG
CGGCGAGCCGAGTGCAAATGCCAGTGACGCATCGTAGCCAAGACGAACCCCATGCTCTCCACCATTTTGCGCAAGAGACCGATATCAACTTTTTCTGCTT
CGTTCGGGACCATATACTGTGCGGCGATGTCGCCGcacagcagcgcaagcgTTTCCACGGCGATCAGCGCGAGCTTCGAAGGCTTTACGCGGTCTGAATC
AGTAACGCGCACTGTTCCTCGCTCTACGAGTGCATGTAGAGCATCCATGTACGCCCCCACTCGACCTTCCAGCAACCACACGTTCCCGTTTGTAGGAGCG
ATATCCATCAATTCGCGCCGACGTCGCTGAAGCAACTCGAACAGCGCAAGACACGCAGCCATCTGGTTGTGCTTCTCGGTTCTCGGGTGAATCCattcaa
gcagcaactgccGCACGTAATCGCGAGTCAACAATGCTTCTTCACTGACATTTTCACGTTTCACCATCCACGCCAGGAAAACATGCAGTTTCTCAGCCTG
TGACCCCCAAATGCAACAATTCATCCGAGACGCAGTGCAATCCCTCATTGCTTGCATCATTGCAATCCCAGCCACAGTGCACACCAAGTTCCGATTGGAT
TGTTTTTCTCCAGATTCTTCCATTTTATCTCCAATATCGTAAGCGTTTGCAATTGCAGTCAAAGCCGCTTGCAGTTTTGCAATCCGCTTGTGGTCCGATA
ATGACAGCACTCGACCCTGGTACAGTAAAAACGTTGTCCATGAATTAGCACCAACCACCAGgaacaacaacttcaaaCAGCAATATACTGCACTAATTGA
CACCTCAGCCGTTCGTTGCAGCGCGTCAACGCCGTCCCCGCCACTAGGTTTCATCAAAGACTCAGATCTGATTCCATTTCTGACACGGCCAAGGCTGGCG
ATAGCTGCCTCCATCTACTCAGCCACAGTGCGTTAGGAGTCCACAATTGGATGAATAGACAGAGAAATAAGCGTAGAAGTAGAAGGACCCTACATGGAAG
AGCTCGCAGTCTTCAAGCACTCGCAGAAGCCGCCCCGCGCTGTCGCGATCCCGAGTCCGTGCAGCCATTTCTAAAATGGAGAATAATATTGACGCTAATC
AAAACAATAATTAGCCATTTTTTTAAAATCAAAACAATAAATTATACAGTACGTGCTTGGATGAAACGATGAAGAACAACTTGTCGATGAACTTGCTGCA
CATTTGTTTATTCACTTGCAGGTACCAACTCCATTATACATACAGAGACTTCTAGAGTTGGTGGCTTCCTACCACCCGGAAGCGTGTGTTACCACTAAAA
GTTTTACTTAAAGCGTGAGAGTGGTGGGGTGGTGGTCGTGACGGACTttgtcgacgtcgaggtATTCCGTGCTGTCGTCCGAGTGTGCGCTCAGGAACGA
CTGGTTCGACGACTGGTTCGATGAGCCTGTGccccgacgacgatgtgACGGGTAATACctgccgtcgtcgcttcCGTTGTCGGTGATTCGGCTCTGAGCG
TTGAAGTCGACACGAGACGTCGCGAAGTTGGCAATCGACTGGTAGCCGTACGAGTCCATTGAGTCGCGCTGCGAGAAAGCCGAGGTGGTCACTCCGAGAG
GACCAAGCTCGTAGCTCTGACCCTCCACATCGTTGGCCTCGCTTCCGTCCGTGCTGACAACAGTCTTTGACCGTTGCTTGAACCAaccgctgctgtcgcc
gtcgaagctgttctcggagtcgttcgagaagatcgacaTCTTGGCCTGAGGACTGCTGCCGTAGCCGCCGTTGTTGGCTGTTTTGGGAGAGGCAGCGCCC
ATAGCGGCCGAGAACGTGTTGTCTTGCTTCGGAGGTGTCGTTTGGGTCATTgtcatgctgctgctggcagatGACACCACTGAGTCCGAAAAATTTACGT
AAGACTGCTCCATCATAGCCACTGAGCTGGCGGTTGAAGCACCCGGGGCAAAGCGATGACCCATAGTCGACGCTCCAGGAGCAAACTTCGGCCGTACTGA
TGAAGGTACAGGGGGCTCAGcaacgacgtcgtcgtcgtcaatgtCGACGTCATCGATATCCACATCCTTGCGCAGGTCgtccatgttgaagctgcgctTC
CTTCGCGACGAGGAAGTACTGACACCCGAGTCCGTACCGGAAAAACTTTCAGCGTACGCGTCGAGCGGCACTGTCGAAGGACGCGAGCCGAGGCCAGACC
CTGTCATCCCAgtcgcaacagcagctcctcctcttgaCGACGCACCCCTCGATGAAGGTGGATCTCCTGATGACAATAAACTGTGAGACGAAGGTTGTCC
TCGAGACGATTTTTGCCCCCGAGACGAGTTCTGTCCTCTCGACGAGAGTGGCTGGCCCCTTGAAGAGAGAGGTTGACCCCTTGAAGAGAGTGGTTGGCCC
CTCCCCGATTTTGGCGAGGTGGAGTATGCTGCTTCATCGGTCGTGTTGTTCGTGCCAAGGTAGGCTGCCAGGACATCGTATGTTGGGACCTCCTGAACGG
GTTCGGGGGCAGGAGTTGGTGCAGCGTTATTCACTTCGAAAGCCTCGGCACTGCGCGTAGAACCTCCGAACGAATACTGTTGATTGCGAGAAACCGGTGG
ACGAACCTTGCCCTTGGAGCGGCTGAAGACCGGGACAGGCTCCGAGACCGACTCCAACATGGGCACATGTTCCGCTTGACCACCGTGCGAACTCTCAGTA
GTGTAGCCGGACATGTTGGTTGTCTGCGATGGatattgttgctgtggctgttgctggtggtactGTCGCGGCtgattgagctgctgctcttgctgctgct
tctgatACCAGTCCCCACCACGACCGGCTGGGGTCGATTCGACTTGTTCGTAATTGCGGCCATTGGTGGACGTGTTGTTGCCAAACTCGAGGTTGATGTC
GGTGGCATCTAGACTCGAGTTGTCcttgccgtccttcttgtgtCGACAGGCAATTATCATCTTGTGAATGATCGTGTAGGCCTGacgcacgaacagcaaa
aagaAAATGAACATGTTTACGCCGATGATACCGTAGGCCACGTTGTCGCGCACACTCTGCGGGAAGTAGTCGTCCCTTGCCACGACAAGCATCAGGCTGA
TGAGCACAACCTTCATAAACACCGACGTGATGCCGATGTAGTACAGGAACCGCAGCAAATTGGGCTGACGGATAAGCAGCAAGATCAGGTATACCATCGT
GATCGCCAGAATGCAGAGCAACTGGGTCGTGGCATCGCGaacaacaccaacaatgGCTCCGGTCATGACTGCCAGCAAAATACGAggcacgaagaagaag
cggttgTCGAAATTGTACTCATCGTAGTACGCACTGTACTTGTTGCTGAACGCCCGTTGATCGTGTTCGTAGGTCCCCACGTCCTTCAGTTCGTCTGTGT
TGTTACCAACGACAATGATACCAAGTCCGAGAGCAAAGAGCACAATTACTCCAAGAGCGACAATACCAAGCGCATATCGAGAGCTGGAACCGTTCGCTGA
GGCATTCGACGATCCCTCCGAGACAAAATAGCTGCCTGCCATCGCGAACATGTACTGCGCCAGTAGCAGAGCCAACACACCAGCCCAAACAACCTTGCGA
TACCATTTGCGCGCCACATCACCGAATGACTCTTTCTTGGCAAGAGCACTCATCACAAGGACCACCACCAAGTACAGCGCGTGCAACACAGCAATCACCA
CAACAAACGTCACGAGTGTGTAGAAGAAGAGGTCGTCCGCGTCCACGCCGATAAGAGCAGCATACCTCGCCGGCCCCGACTGTCCAGCCGCGGCCACGAC
ACCTGTGCCACTGGAACTGGAATCCGCAAGCCTTCGAGTAGAATCATCGCTACCGTCACTGccgcttccactgctgctagaGTCGTCATTTCCTCCTTTA
ATCAAATTAAAGTTCGTCCACGACAATTCCTTCGAGAACTCCAACAGGAACGTCGGTGCTCCTTCAATCCGCAGTTGACTGATCATGCCAGCGAATTGGG
CCTGCTCGACAATGTGCGTCATCTCGTAGAATCCTGCTGAAAAACTCAACGCCGCAGCCGCACTAGGCACCGCTGAAGCCCAGAGCATCGAGCCTGTGCC
AatcactgcagctccagccaaTGAAGTGGCGATGACGCCCGACGCCGTGCTGCCAGCCTTGGAGTCCAGGAAGTGCAAAGTGCCTGTGGAGTTCGTAGGC
CATTGAGTATTGCTGCCGAAGACACAGCCGGAGCAGCTATTGGCTTCGATGTAGCTGGTGTTCAGGTCGCCGATGTCCACGTCGGACGAGAGGTTGAGCG
CGTGGCGGATCTGGTCCTCGCCCCAAGGGATCACGTACGTGTAGAATGCCAGACCGAACGCGGCCAGGATGCCCAGCGGCAACAATAGCGCGCAGAGCTG
CGAGAGCGCCATGCAGCCGCAGCACTTGGCAgcgcagcacagcagccCCATGCTCGAGTATTTAGAGAGCTGTTCTGTTCGTTCAGTACGAGGGCggcgc
tcgtggtggtgggcCTGCTGAGGGGAAACTGGCTTTGGCTTTGACGCCACGGGCTTTCGACAACTTTTTGAAAAGCTTCACTGGATGCAGAGGAGAAACA
GAAGAACCGTCGAGCTTTGGATGGGACGTCGGACGAGAGAACTGCAAAAGAGACGGATACTGTTCGTACCCCCCGTTACGATAGACATGTCATTCGAAAG
GAATAAGCTGTAACGTAGGTTAGTTTCGATAGCATTCTGTATTCATAGCATGTAATATACCAGGTTTATGCAATATTATAATCAGCCAATCGCTGCGCGA
GAAAAGTATTCAGTAACATTTCGGTGCCACTTTGATGTGTGTGTGAGACGGGCCGGTGCGCTCTTTTGACAAGGTCTCTATTGTCGACAACAGACACAAA
CGAATTGTTCAACCTCGCGGTGGAGGCATGTGGGTGCAGTGAAGAAGCCCGAGGGCAGCTGCACGGGAGAATTTATCCACCGCAGCGCTTGGCGCGCCGA
GTTTGTAAGTATTCCGGCGCTTGTCCGTGGTGAACTTGCTTCGTTGATCGACAATGGGGCCAAGGATACAACTATGCCGCGCTACTACACACTGCGCTTT
ACATaccgtgctgcagccaacgGTTCTCTTTGCAGTTAGCTTTTACAGTCGCGAGCTAGAGCCTCCTCTGCAGAACGCACTTCAGCGATGTGGAGTCTTC
ACTCCAGGGCTTCACTCTACGTAACTCACCGTGGACAAGAACACAGCGAAAAAAAAATTTGGCAATCAGTTGGGTCGTCGACGGCTTCAACAACAAACGT
CACCACCTGGCTTTCGGGTGCCTCGGCGAtgcggcggcagcaacatTACTTTGATTTCTAAATGCTACCATCATGTCTAATTAGTTTCTAAGCGTAATTT
GCAATAAAATATTTCTAAATGCTGCAACGATTTCTAATTATTTTCTAAGGGTAAGTTGCAATTTTAATTTTGAATTCGTGTGCGGCAGTAGCAATGACTA
GCGAGACGCACCCGTTCGAATGGTACGCGCGACGCTGTCGCTCTCGCCACTAGGACGCTCTTCCTGCAACCACATTACTGATATTTCTCTTGTTGTGTAC
ACTGGCAGCGACATCAGCCTGACGTTCCCCGAGGCGGTAGACGCGCAATACGTGCTTCAGAcgctggacgtcgacgccgagctgcagcccGACAAGATCC
ACCGTACGCTGACTGTGAAGGGCACGGAGCTTCACGTGTACGTCCATCCCTTGTATTTTGTGTCTGCCCATTTTCCTCTTGGTATGCATTGGTGCTGACA
TTGAGGATGTTGTCTTGTGGTTGAATTGGTGGTTGTGGTGCACTGTAGTCACTTCGAAGCCACGGAGAttcggctgctgcgcgcTGCGGTGTCTTCTTTC
TATGATATGGGTGTACTTGCAGCCaggacgctgctggagtttAAGGAGTGAGCAGGGAGAGAAGCACGAAATACAACATCCCGGATTTGTTTGACCATTC
TGACTGGA