Description :
From Genome Similarity Track
Location :
Scaffold_2582:334- 2803
Transcript NameFunction/comments
Phypl_g15225hypothetical protein PHYSODRAFT_543861

Sequence
2469 bases(100 bases per row)
ACGGGCACTGAAGGCTTCGCGATGCATGCAGGGCTTGGCCATCggttgctggaggagcaggaaaTCGAGAACAATTACTACGGAGAACAGAGGCTCATGG
AGGGCGCGCTCATCAAACTGGGGGACTACGCGCACTATCGATATTTCCAGCTCTTTCGCAGTGGACGCTTCTGCTACTACGAATTGCCAGCGCCCGCGGT
GACGGCTCAAGGAGTTCGAAGAGTTCACCTGACGTCTAAACATCAACGTGGCATCATGATGCTCCACGCATCGATTCACGGTACGGACCTGGTCAAGAAT
GACGACGAATACGAGACCGACCTCCTAAAACGCGGCCTCGTGTTCAgccgcaagaagctcgaactgcagctcACGGGGTACTCGCCAGCAGGCCAGTTGT
TGTCGTGGAAACTTCGTGCCAGCAGAGACGCTGTCTATCTCAAGTGGGAACACGCCTTTCGCCTCGCGCTACGGCCTCTATGGGTGTCAAACTCGAATCA
CTGTATGGTCTGCAAGAAGGACTTCACCTTCTTTACTCGCCCACACCACTGCCGGTACGTTTGGCGAGCTTCATGCGGATGTGATGTCGATGATATTTTG
ATACTGACGGGTGACGATCGTGCATTGTAGCAAGTGCGGGACGTGCATGTGCGATGAATGCACCGTGTTTGCCCCGCGATTGCCCTTGCAAGGCTACTAC
GACGAAGTGCGGATCTGTCGAGACTGCTCACCGATCAGCATTCCGATTTCATCGCTGGAGCCGGGTACGCGTGTGCTGGTCTACGGCATTTTCATAGGTC
GCGTGGTGCAAGTGAATATACCGGAGGGCACCGAGGGCGGGAGAGCACTTGTaaaggtggagctggtgaaaCAAAACAAACAGGTGCGGAGCTTTGCCct
ggagcgcgtcgagctgTACTCGGATGCAGTTCTATCGGCGAACCGGATCAAGAATGCGTTTCGACAGCACCTCGCGTACTCAGTGTTTCGAACCCGCCTG
AATTTCAACACGTGGaacgtgctggaagcgatgCAGGAGCAACGCACGATGCAAATGGTGCGGTTCGTACAGCAGTCGATGAGTATTAACGACTTGCACT
CCATGATGCCGCTACTTGGGGGGTCTCTAAACTCGCTCGACGGTGTCGTtttggagaaggagcgcgtgAAAGCCTCTCTTGCCCACTATTGCGGCGTCCG
TGTGCTGTTCCCTCTGCGCCTCAACACAGTGAAAAGGCTGATCAACCAATTTCGCAATGGCATCTTGCTGCATCCTGTCTTCGTGCGTCGTAtcctggac
gaggcggaAAAGCTGTTTCGAACCCAGCACGAGTCCCCGATGAACTCGGTTGAGATTCCCCCCGGAGTGAAAATGGTTGTCGTGGGCGACCTGCACGGAC
AGCTCGAGGATTTGCTGACAATTATGGAGAAGAACGGCGTTCCAGGCAGAAGAAACTGGTATCTCTTCAACGGCGACTTTGTGGATCGCGGAGCGCATGG
AGTCGAAATTATGCTGTTACTGCTCGCGTTCAAGCTCTTGTATCCAGCATTCGTCTTTTTGAACCGTGGCAACCACGAAGAGCGTATGATAAACGAGATA
TTTGGGTTTCAAGCCGAAGTGTACTCCAAGTACGGCGCCAGTAGCGACAAAAGTGCCGGCTGGGGTGGACTGAGCTCCTCAGTCAACTACTCGGCGTCGA
ATCTCTTCCAGAATTTCGAGACGGTCTTCAATTTGTTCCCGATCTTTGCGTTAATTAACAGGCGTGTCTTCGTCGTTCACGGAGGCTTGAGCAACCACAA
GGACGTCACGATAGGGGAACTACTTCAGCTAGACCACCGAGGCGAGCCAACGCAGGGGACCAGCCGCACAGACGAGCTCCTCATGCACCTTTTGTGGAGT
GATCCATGCGAGGAAGATGGGTGGAAGCCTTCAAGCCGAGGGGCTGGAGTGGAGTTCGGCCCTGACATCACCAAGGCCTTTTGCAAGCGGAACGGCATTA
GTCTCGTTATTCGGTCGCACGAGTGTCGAGAAGAAGGGTTCGACATCGTTCATGACGGACTTCTCTTGACAGTGTTTTCGGCGTCAAACTACTGCGGTTC
TCAAACCAACAAGGGGGCCTACGTTTTGTTGGAACGGGGAGAAAACGACGAGATCCAGccgcgcgtggtgcagttcTCATCGCAACCGCTCCAGCAACTG
AGAGCCGCGGGGAGGAACGAGTGGCGAGAAAAAGCTCGGCGTTTGGAACGGCAAACTTTGGAATCGCTCGTGAAGTTCATCTGCGAAAACTATCATGCGT
TAATGTTATCTTTCCAGCAGGCGGATGTtacgagctgcagatgcaTCTCGAAGGTCGCCTGGAAGTCAATTCTGAAAAGGGTGCTGGGAGTTCAAGTCAA
CTTCCTCTCGTATTTCCACCTACTTGCCACGGAATCTGAAAAGGGAGGTGTCGACTACCGAGCATTTCT