Description :
From Genome Similarity Track
Location :
Scaffold_188:33398- 34667
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_188-fgenesh-gene-0.10Hypothetical leucine rich repeat protein

Sequence
1269 bases(100 bases per row)
AGTCGCCTAGATGGCCGGGTTGCGATGAATGTACGGGAGGTTGCTGGGGTTGTGCTTGATCTGCATGCGCGCTCCCTGCTCCTCGTCGATCGTGATCACG
CGTGGGGCCGTCATCGGCGGTGGGCCGCTCTCCGAGTGTCCGAGCTTGGCCTCCACACGCTTCGTGAGCGCCGCGACCGATCGGACCGAGTGCACCGACC
GGATCGACTTGCACTCGGACAATACTGAGCTCGCCACACTCCGTGTGTCGTCGTCGTCGTCACCACCGCCACCACCGCCGCCGCCGAACTGCTTGCTCAT
AGCACGCTCGAGCTGCGCGAGGTTGTTCCCCGTGAGCGCCGTGGGCTTAAAGTCGCTGCCATCGTCGCGCTGCTGCAGCAGCTCGCGCTTCTCCTGCGCC
TCCTCGTACTCGACGATCGACTGCACCTGTGCGAGCTGCTGCTCGATCTGCGCCACCTTGGCCTTGAGCTCCACGTCGTCCATGAACTGGTCGATGTCGA
GGTTGGTAGCGAACGCGATGAGGTCGTCGGCCTCGGCGTCCTCCATGCATTCGAGCTTCTCTTCGGCTGTCTGTTTGGTGAGAGCCCACATGGGTCGGTG
CAGACCCTTGCTGTCGGCCGGATCTCCATTGTCGTCGTCGTCGTCGCCGTTGTTGTTGCGAACGGCCTCGCGCCGCTTGGCTTCGCGCTGCGAGAACCTG
CGCGCGCCACCGACAGCGTCAATCAATGAAACAAATGCCAGTGACACCAATTCCATGTGTGGACGTACTTGTCCTTGCGCTGGCGCCTCTTGGCGTCGTC
CTCGAGCAGCTCCGCCTGCAGCCGCGCGCGCTCCTTCTGCAGGTCGTGGAGCCACTTCTTGTGTTTGGACAGCGCCGTGTTCTTCTTGTCGCGCTTGATC
GCGTGCTGCGGTCGTAGTCACGCACTGTCAGACTACGCTGTCGAATGGATCAAAGGACCGGCAGGTAGGTAACACACGCACCGCAGGCTCGCTCAGGATG
GGGACGTTCATGCCGAGCGCCTCACCTGGGTTGCCGACAAGGAAGGCAGCCTTGCTGTTGTCGAGCACCGACGGCCCAGTGGTCATGGCTGGGCCACTGC
GCGCCTCGCGAGCCAGCGCTGTTTTCGATCATCAGCAAGTTAGTCGAGTGCCACACCGCTAATGTCAATCAATGCCAAATGGCAACGCACTGGTGGCGAC
GCCGTTGAACGGCCGGTTGCACAGCATGACGCCCTTGTAGTTGCCGATGCTGACCGCCCCGCCATTGTT