Description :
From Genome Similarity Track
Location :
Scaffold_177:33391- 35974
Sequence
2583 bases(100 bases per row)
TACGGCATAAGGAGTCCAACGTAAAACACGGAGGGTGTACGCAATTTTAGCGGTAAGTGAGCGTATACGCAATGCCCTTCTTAGCCACAACCGTAAATGG
TCCTATGAAGCGAGGACGCAGCTTCGTCTTAAACACAGCAGACACTACATTTGTAGGTAGATTCTTAGCGTTTAGTATGACTTGTTCAACGACCTCATAA
CTTTCAATACAGCTTCTGCTTGTAGCATCCGCTTGTTCCTTCTGTTTGTCTTGCCTATCAGCCATTGCGTCACGCATGTTTCTGAAGACATTCAATCGCG
TTGTGAGGAACGCGCTAACCTGTTTTTGAACAGTACCAGGGTTGACATCAGCAAGCCGATTGGCCACCTCTCCCCACCAAGCCCTGAACCACGGATTGTT
AGCGTTAACGGAACGCGGGTGTGTAGGCCGTTCATGTAGAACGGAGTATATCCTCTTGAGGCATGGACGGCATTGTTCATGGCGAATATACTGATGGGGA
GCATTAAGCTCCAACGCCGAGGCGTAACAGCTCACACGCTGCGTAGGACATTGTCGAGGACGCGATTAAAGTGCTCAGCCTGACCATCGGTCTGCGGACG
ATCCGCTGCAGACGTGTTTAATCTGGTGCCTAGCACCGTGAAAATGGACCCTCAAAGTTTAACCATGAAACAAGGGCCTCTGTCCGAGACAATTGACAAT
GACAGACCATGTTGCCAAACCATGCGATCAATGAACAGCAAAGCTGTCCCTTTACCACCAATGCAGTCCGGAACAACCGCTGAGTGAGAAATCTTGATCA
AACGGTCGACAAAGACCACAATACCAGTGTTGCCGTCCAAATCCTTCGGTAGGCAAAACGCGAAGTCTATGCTGATGGAATCCCAACAACCAGAGGGTAC
AGGCAAAAATCTAGCTAGAGGCACAGCCGCATGTGCGGAGGATTTGATCTGTTGGCACGCCCCTACATGTGCGCACATAAGTGCTTACCCATTTTAATTC
TTAGGGACACCAATAACTCTGGATAACTAAGCCGTATGTCTTCTCAAGACCGAGATGACCGCTACGCGCTGTGTCATAGACCTCATAGAGAAGTCGGTAC
GTCAGCTTTTCATCATGAGGAACAACGATACGCAGGTATCCGTAGCATGCGTGCGATAGCACAAAAAGCCATTATCGATAGAATATCGATGTAGCCCGTA
AGCGAACATACCGACAATTTAATGTCCGAGTCCTTAAGATAATCGCTTGCAAGCGCTCGTAGCAAAGATGCACATTGTTCATCATTGGCGTTCGACGAAA
GGATTGAGTCAGTATGACGACGACAGAATCGTAACATGAGAAAGCTCATAGTCAGGTCGGCATGACAACGCATCAGCCAAAGTATTTTGCCCCGGCTTAT
ACTTCACCCCGAAGTTGTATTCTGCAAATAATGAAAGCCAACGGGCCATCCAATGCGGGAGGTGAGGTGATTGAATCGCCGTGCGTAAAGACGAATGATT
GGCATAAACCACGAAAGGCTTAAAGCCAAGCAGATGAACTCACAAGCGGTAACCACAAGCGGTAACACTCTCGCGTCGCTCAATATCTGTTTGTAACAGA
GCACAGACAAAGGCAAATCGGAAGCGTCACAGACAACACTGAAAGGTCGATCAGAATCTGGCAAAGCCAAAATCGAGGCACGTCGGAGACTCTCCTTTAC
GGGTTTAAACGCCTCATCTTCGGTGCTAGTCCAGCACCACTCCATATCCTTTTTAAAAATATTGGACAATGGACGTCTTATATCAGCATAAATCTCGCTA
TACTCGTGTAAGTCAGTGGCAAGGCCAAGCCACTTGTGCATATCCTTTTGGTTATTAGAGACTGGTCAATCCACTATGGCCTTCAACTTTGCGGGATCCG
TCCTAAGACCTCGTTTCCCAACGAAGCATCCCACAAATGGGATTTCGTCCGGACCAAATATGCATGTTGACGCATTATCGTACAGCTTATTTGTCGCATG
CACTCGAGCACAACTCTTAAGTGGTCGATGTGGTTACCCAGTCCGACCGACCCTGTACTACACGGCCATGTGAAAAAATGTCATCGAATAACGTTCGTGC
ATAAACAAGGTGATGGCGGAACAGTTGCTTCACCAGACGATTAATGTAGTTGAGGCATTGGAAAGCCCATGGGGTATTACCAGCTACTCCCAAAGCATAC
CGCTCGGAGTAATAACCGCTGTGAGCAGGATATCACTTGCTTGCATGAGCAATTGATATTACCCATCGACCAGTTCGAGTGCATAGTACATTGTACATCC
TGCCATGTTGTTCTAAAATAAATCCTTTCTAGGAATTGGTGTCTGGGCCGGTATAGCCGCATTAAGCTTATTATAAGCATGCACAATGCGCCACTTACCA
TTAGGCTTTTTGACACAAAATATCGGTGTGGAATGAGGAGACTTGCTCTCATGTACCATTCCAGCCGCGTTCTTAGCACTGAAAAAATTGTCAATGGCGT
CACATTGTTCCTTTTGTAAGGACCACTGCCGTGTAACGCAGTATTTTGGTTCCAAAAACCAAGTCAATCTCACGATGTACACC