Description :
From Genome Similarity Track
Location :
Scaffold_72:3339- 10248
Transcript NameFunction/comments
Phyca_LT1534537036Hypothetical protein
Phyca_LT1534537037predicted protein

Sequence
6909 bases(100 bases per row)
ccggatatcaagtctgaaaggatggctacacttgttgaagtatgactacgtgtacacttgttgctgtcttgcgcgaattgcctcggccgcagaccctcga
ggcgtcccgtggtccttgcgctgctctggcgaaatacccttcagcgacgggatgtggatctctggttctgtctcggaggcatttggactgtcgtcgtcct
gccggaagaatgccacgaggtctgtgaacacatcgaagctcacctgtgtcaggaaaagtaacgttaatgtcgattaactacagagagagactcctgatag
tcgtacactgaatgggtgggcaatcttaaaccgcacgagaacctccgttagttcgctagtcgtcacgccaattcctaacacattgaccaaccccaatcgt
gctgcaacaagtagagagatcagaggctgccaacacaaaatacgagtatatattgccacgtactctgtgcgacggatagtagacctctggcttcgtcatc
agcctgagagaatacggaccagagcagctccattgggtcgtcaacctctgcagtgtctccaacatcgccatcgctcatatccgaactaaagtgtccaaac
tcatcgtccgagtccccttcattttcgccctccccgccttctccctcctgaacagtttccatacgcaaagggctcaactcttgcggtacgctctgtgctt
tcatctcccgcaccttctgtcgagccatcttcttccgagctcgcgttgctttatacgctgccaaaactttcttttgcattgccaattcctgcgcaatcac
ctcaggctgtcgaggatcaaccaccttgtaacattccttaatcgcctcgcggtcttgttgccactgctcccacttggcccaaccacaatgcatcacgttc
agttcatcagcagacagcggctgaatctgctcgattcgcctcacagtcgtgaattgtttgtacgccaccatgcactttatctcgctgaagtagttcggta
ggtatttaccagcagttgccacaggcacttgaagacgtttgaattcctcttgaagtttcgtgtcgttgaatggaggctttcggttttcagagtcaccccc
acctgcactcagtctacgcaaaaaaacatggcaatgacgagtagatgactccatttccatgtcatccacttgattttcaggccctgcatccattagatat
tttgcaatatctcgaggtctcaggatctctagcccagtaccatcgccattaaggacgaaaatgtggggctgaataggttcgttaatgactgcttttgctg
gaatactatccacatcgtaccgagaagcctcggcgtcactaacgactccagcgagatcaacagagacaagtggccccggcttctcctctgtcccgttgaa
atcaacatggaattggttctgctcattgtcgcaacactggaattggccaaggcggtagtcgaaatagtaaaccccgttgtgacttgtgacgttccgatcg
tcgtcatcttttgagtcgaggccgctccgaccctcggatctatattccactcttccactgtcttttgacacaatgacttgcccattgggtttccgcgtta
taactcggccgttcacctgcgccgtaacctttgtattgtagctgatctcgacgctcgttccatcaaacacattcactacgctacgcacacgtagccctcc
tttcgtaactgccacaggctcccctgctgcatggcactgagctgtactgttgacttccacatcaatacaaacgtcggcaaaccctcgcttctttacaagt
acgtgtgagctcccagcattcatgtacatccgtgtgccatccacatgatacgtcacacgagcaccactagtgaatgtgacaataatgacaccgctgggac
gtcgctccaccaatgcgttggtctcggggtctactgtgagcgtcgtaagtgttggaggatgaaggtctttgttatggctgattcctttctccgagctgtg
gcggtgttttgtacaaccatgaacaacacgtacaattccactagcaagcaaaacttcctttctcccgcatcgaagcacccgaagaacgctcccctttccg
tagataacgcgatacttctcttctttgtccattttatccagttctctcactccacttgcatcatgatccggaggttcatttgtagcactagccatagagc
tcttgcccgaggcgtagcgctgagtgatggtgccatccgaacaagcagatacaataagcccatttggaaacgagttagtcattgtgacagtagggaattt
atcgggctttttcgggagctgtctcctcccctgggaaatatgcagcaccgaatcgtcctggaaggacgcaatgaactgcaacgtaatctccgaactcggt
tcgtcacgatcgattccataacgtaaattcttcgtccccgatcgtaatccaaacgtttccctagagaaaatgtattagttcaaggcgatacaacatccaa
caaaagacaacgcacccattgcgatagactgtgagccataccaaccctcgaggggtctgataaagccgcaccacactgtgatcagcaggatacatcgccc
aagtttgggcgcctacaagtgcaagctgcccagatgacaacgggatacatgcacgagctgcggcttcggttcgtggtgtaagatattcttttggagcaag
ttcttcacgcttccaacatttaaaagctgggcggtggcgtacgttgtcgaccgctgcccaggaagacacttgcattctgccaggagcagttatcgggaga
gtcgccagcaatagtgaatccgtaggcgcgtagtatctggaacatacattgggcgagttttgctgcaacacccaggaaattcgttgggggagaactgtac
gcgtcaggttttcgataaaagcgcggggttgaagtttccccctccaggagctccctagcatctcttcgacttctaaaagttgctttgttagatggatcat
ccagcaattgaatcgaggcgagtcgtaaaatgttgcgagctccgtgttgcgaacgaaacgctctggctcagataacgctggtactcgaggcattgccttc
ctccctccattgcctacaccaggtaaatcactttgcctccacatagcacgttctacgtcgtcaaggcgatggttcccgtggggaataaaacaagagtccc
cttcttctcgcaataattcgtgataaagctgagcattcgcgagccggcacgaaactaagtcgccatattcgaggaattcctcaagctgctgtggatctgc
ctggttagttaaactggtacggtactgtttaactgacgtcgtcagaacgggaagcaccattgccacagcctcaacgataccaaacagaaccgtaccgatc
ccgacactgccgggataaacaccgcttaacacagattcgtacgcatcgtagagtgcactattgtcaccctcattgtcaggaatcactgagaactttgttg
accctacccagtccttaaagtagaacttctgggtggcgatcgactctacagttgtgattagctcctgttcaagctcggcaggagatttaatccccgacat
ttctgtgctgcagtctacgttcgtgaaagtgaagtcgctccattccagtcctcccacctgagcagcctcataaaatgccttcacaacagtattcgacccc
tgaaagaccgacgtctcgatcgtcgacattcttggagcattaccgcccactttcataacagacttccgagctgggctagttgggtttcgagctcgacctg
ctgccacgtccagaggatcagctaaaagaactaccccgtcaatcagcggcagcaacggcagtctttcgggcctgatcgtactgccaacctctcccaaccg
caacagttcgtctacctcggacagagaagtagggtagtccactaagaggtacacgcgtgcaggtgtctgcactgattccccgatcttccccatgtacctt
ttcccagtatctccctcagtttcatctacatgtgcgtctgtctgctgatatacaataaactcttgcttgtcctgactgacaagacgctggaaggcgagcg
ccagcagcgacggcgtcacagcaattcgcgtaatctcttcctcctccgtctcctccgcttccactggtgctgtcccaccctctatactagtttcttcctc
ggtgtccttctcttcgcgtcgcttggcctctaattcctccgcatacgtcacttggcagatctcctccagctctacgcgactcacgacgcgatacgagcag
ctcctcgcccagctcgacagctctgcatccgccttgagcctatttaccagttctttcttagccgaaagctccccgttcgctgagccgctggcgagcgcca
ccgtgtggaagccccagcgcctcataacgtcgcttcaagttgaagcccaagtagaagctgttcccacttaagtgcgatcaagctcaaaagtcttattatc
tgatggcaatggtcctcgaacgtctgctactcgctgcttgtgtgctggttctagctgcagcagacgctccatgcaacgagaggaagctgcatcgagacgc
tgtgatgctgctggcatcccacgtggacgtggagctaggcggcgtcggagcaggcaagcgcgaggtcgtgggctttcagcatctggtaaggaaaaagaag
cacttcaactacaaatcgtagtattaatgaactataactgtagaaacctgctgaagcccttttggcggctcaagcgctggctcatgaggactttaaccag
gcagcggggcaggtccaacggatcctcgagtaccagaagccaaacgggttactgccgcacgtggtctacgggccgtccgttccgtccaaactgcggtgga
tttcaagcaatcgcacttttcacccaggtccagcgttctggcagcaaccgctcgaagaccagaaagaggagaaccctagctctcccctgcacacttcgac
gatttcagctcctcctgtggctgcagatgtggcctgggaaatcttccgcttggctccgtacgactcggtgctgggtgtgaggaccaccgcggtgcagttt
ttgtgcagcgtttataagccgctcaagaaactacaggagcatttgttcttcacacgtcgaggccccgctcctagcagtttactgactgctcgtgtacgtt
tgactacgaattgcacaaggaaaagatgcaagctaacccttagatgtatttacgatctttcttgcagcatccctgggagacgttttcgtcaatatcacca
cactggaaagcatttctcgctgaaatgaaaagtgcatcagattacgaggcaactatcaagtctattcccagcgaagcccgagctcgctttgtagcaggag
ctagtacaattttttcagcgcgagacgcaatagagaacttatacgagccgatgatatatctcgcggctcagacgcgccacgaggacgccagagaaatcta
ccgccgcgaatccaccgtgcttgagtctatcgcctacaatacggatggtgacaaggttactcggtttggggtcgaagatgtggaattcaatgcgcttatg
ctgcgatcgtctttgagtcttgtgaacattggtcgtgtgcttctggaacactcatccgtgtgcacgggattcacgctatcggaggaagaacttctggacg
atatgaaagagcttcactcaatggcgaagggtcttgaaggggctctcattggcaccaacactactcaaggtctgtggaacgcatccgctgatttcttcgc
tgactcgagcaggttttcattgacctcagcacattcattgcgcggatttcttcctggatacgcggcagaactgaacgacgacaagaaaatgagctcaatg
aagcattttctttcggaaccaggcacattttctttcttttgctcccagttcccagcttcttttttcgcgtgctctgggaagccactcgatgttgatggat
cgacgagcagcaggccagcagctacaacgtggatcctctacaactatttcttgcagcgagggttcgctagagtaagcgttgcttctcactctggttttgt
gctgtaaacactaacatctttttcattcagaacaagtttccaggactagctgattacatccgcaacaagactcgagatatggtgtgcgaggcaactacag
cgtctactgaactaccttcttcgtggttctcattctcattaactgcgaatgaggctgcacccacagctctatctccagcctacgactcccacaacgccac
gccagtccaagtttttgacgatagttatatgggatcaccgctctccgccgccgtacttttaaatgtgctgctgccagcaggtaatagtagacttaggata
cgcagtgcttctctacaatgcctgacatattatttctttatgcccaacagtgactccaccaccaagtccagataccccacccattgatcaccgcattctc
tctgttatcatgtgcgtcgagttagtggtcgcgtttggagtcgctatgagctgcttcctgttctcggtgtattttgtggcgaatcggccacgagaagcgt
ctggagcacgccgaaagtcggctggaggaaagaagactcgagacaaatcggatcgtcgtatggaagactcggagggccgtgagcaatccagtgccagtgg
gtcgtcgtgggctgaaaggtactcggagtcatcttacagtgactactctccgcgttctggtcacacgccgtatgagttagaggaatctttaatttcggac
gaagacgagcattacggatccttcgacgaggcagcacagccggaaacgccgtccaattcagcatggaaatccgttaaaaaggcactagcggacatcagtc
cctggtaga