Description :
From Genome Similarity Track
Location :
scaffold_362:33388- 35059
Transcript NameFunction/comments
g7672.t1 reverse transcriptase

Sequence
1671 bases(100 bases per row)
GGCTGTGGACGAACACGTCGTCGAAGTAGCTCGGTGCGAAGTCGCGCAACGAGCGCAATAGATGTGTCACGCATCTATTGAATGTCGCAGGGGCATTCTT
AAGTCCCTGCGGCATGACGAGCCACTCCCAAAGCATACCGCTTGGAGTGCTTACCGCCGTGAGAGGTATATCCCTCTCACGCATGAGGATTTGATAGAAT
CCATCACGTAGATCTAGAGCACTGAAGATAGTGCTCAAGGCCATCGAATCGATGATCACATCTTTTCGCGGTATCGGCGTCTGCGCCGGTATCGTCGCAT
CGTTCAACTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGGGCACTGTGCGGGGACTTTGATTCCCGCACTTG
ACCTGCAAGACGACGACTTTCAAAGAAGTCGTCGATCGCTTGCACCTGTTCGCGCGGCAGTGGCTACTGCCGCGTGACACAGTACTTCGTGCCCGGCACG
AGATCAATCTCGTGCTGTACGCCTTTATCCTTCGGAAGCTCCGAAGGAATATCGTCAGGAAGTACATCCTTGTACTCCCGCAGAATGTCGTAATAGGGAC
TCGACCTCAACGAGTCCCAACTCTGCTCCTCGAAGCGCTGCTTCTTGGTCTTCGCACTGAGGGGGTTATCGCCCTCAGTGATCCCATCAACGACGAGCTG
CTTCAGCTCTTCGGCCTCGCGTTCCACCCTCTCAACGTCTGAGAGGATGCAAATTTGTTCGATGCGTCCATCGTACAAGTCCCGCGCGAAGCGCTTCCAA
CTCATAGTTGGAAGTGCGGTCAACGCCGACGCACACGCCGGCGGATTCTCTAACCGCATCTTCTGGTACTGTAATCCAGTACCAGTACGTGTCAAGACGT
TCAACGTCTCGACACTAGGTGTCTGCCCGGCAGATACACCCGTCTCAGCCCCGGACTGAGACTCATGCAGCTTCTGTGATTTGCGCCGTGAAGTTCTTCC
CTGGAGCCCGGCTCCAGGTGCTCCGCGTCCAAGGGCCTTCGCCTTGGACGGGTCGTTATCACAATAGTCGTCAGCGGATGTCTTCCGCTGACTCGCACAA
TCAAGCCCGGCTTGTGTGCCGCTCATCGCGTGCAGCACTGCTGCACATGAGCACGCAGGTTGTTCTGGTGCTGGACGTTTGCAACCGCCAGCACCTCCTG
CCGCGTCGTTAGTTCCCGGAACTAACGCGCCTCCATCAACTCCCGGAGCTGATGTGCCTTCACTAGTTCCCTGAATTAGTGGCCCTTTGATTGTGACGTC
GACTCCCTGAGCCGACGCACCCGCACCTGTGGCGTCAGCTCCCAGAGCTGGCGCACGTCTATCCGTTCCCTGAACAGGAATTCTATTGGCTTCGTCAGCT
CCCGGAGCTGACGCGACGTCGTCGGCGCGACCCTTGGAGGCTTGAAGTAGTCGACAAGGGTCGCCGGCGGCGATCGGAGGCAGCTGCTACCTCAGCTGGG
GAGTCGCATGCACCGGCCGGTGCATGCGCGGCACTGACAGGGCCATCGCTCTCTGTCGCGCCCATGCTGTTGAAGCGTACAAGCGTACGCTTCTCCCAGT
TGATCACCGGGTCATGCCGTGCAAGCCACGGCATGCCTAATACCAAGTCGAACTTATCGTCTAGATCCAAG