Description :
From Genome Similarity Track
Location :
contig_42:33385- 34489
Transcript NameFunction/comments
g7683.t1conserved hypothetical protein

Sequence
1104 bases(100 bases per row)
CAAGTTTCGTCGACGCCGCCGAGTCCGCGAACATGCTGAGCGTAGTTGCCTTATCCTCGATCTTGCTGTGCGAGCCCGGCGCCAGCAACGCCACATCCAG
GTCACGCACTTTGGCCACACACACGCGACAGAACTTGGTCTTGACAACTTGAAATGTCTTTAGCGTGTCGTCGCCTTCCCGTGCGCCGCGGTAGATTAAA
CACTGGCGGCAAAACACCTCGCCGCAGAGCCGACAATGCTGGCGGCGGCGTGTGGTTGAGAAATCGCGCGAGCACAAGCGGCACTCGGAGCGCGCCTTCT
TGTCCGCCCAACTAGTGCGCCTCATCATGCCGTGCACCGAGATGAGCTTCGAGTCGACCCAAACGGCCATGTCGTTCATCTTGGTCATAAGTCTCTTGAA
GTAGAACCCGGGCACCGCGAAACCCGCAAAGTCGTTTTGACTCGTGAGGAACAGCTCTGTCGACCTAGGATCTCCGTCCGTCGGGCGTACGATAGACACG
ATGAGCATCTGCATCCGCTTGGTCTTCATTTTATCGGGCAGAGGCGGGCATTCCGGCAAAGTCAGCGGCATATTCACGCGCACGCCAATGTCTCGGCCCC
GCAGGTCCTTCGTGAAGGCCATGTACTCGAGGAAGCAGGTGTCGCGCTTCTTGACGAGTGCGAACGGCTGTAGGCAGGTCCATTTGATGCCCAGGTACAA
GTACGGCTTGCCCGACGAGCTCGTGTGGATGTTTTTCAGCACGGCGGCGTCCACAGCGTTGCCGTACATGAACTGGTTCCAGGCGAAGAGCTGGCTCGAG
GTCTCTGCGTAGAAGAAGTTGAGGAAGTTGCGGTAGTCTCCTTGGAAGCGCCCGAAGATGCGGCATTGGCAATTGGCGGCGTCGCCCACCTGGCGTACGG
CGGTGAGGTCTGCGACCTTGCCCAGCGTCTTCCAGCCTTCGTCGTAGCTCGGGTTCGAGCCCATGGCTTCGTGTAGGTTGTAATCGGCCAGCGCGTTCTT
GACCGCGAGCGCCATCTTCTCCTCCAGTTCGAGCACCTGGAGCGTCGATAGCTTGACATCCGGGAAGTAGTCGTCGGGCATGGGAACGGATTGCTTGTTC
GAGC