Description :
From Genome Similarity Track
Location :
Scaffold_105:33383- 40025
Transcript NameFunction/comments
Physo_141900ATGSL10 (GLUCAN SYNTHASE-LIKE 10); 1,3-beta-glucan synthase

Sequence
6642 bases(100 bases per row)
CCGCCGGCGCGCGAGCTCCAACTACTTCGAGCTGGACGCCGACCGGCGCCGCAACAAGTCGGAGCGCAGCGAGCGCTTCAGCAAGCGCCTGGACACGATG
GACGTGATGCCCGCAAGCTTCAAGGGCGCGACGCTGGACGACGAGGCGGCCGTGGACTACTGCTGCGAGTTCCTCAAGGCTAAATTCGGCTTCCAGGAGG
GGTCGGTCAGCAACCAGCGCGAGCACGTGCTACTGCTTTTGGCAAACGGCAAGGCGCGGTGTCTGCCCAGCGACCCGGCGGACCAGCACCTGGTGCAACT
CGCCAACAAACTGTTCAGCAACTACCGTTCGTGGTGCAAATTTATCCACACGAACCCGGTGACGTATACGGGAAATGGCATCCCGAACTCTACAGGTTCC
GGCAATTTGCACATGGACGTGATGCTCTACTTCCTGATTTGGGGAGAGGCCGCCAATATCCGGCACATGCCGGAATGCGTGTGCTACCTGTTCCACCAAA
TGCTGACCATGGTGAACGCCGACCCGCAGGGCCACGAGCAGCAGCGCGAGGGCTGGTACCTGGACCAAGTGGTGCGCCCCATTTGGCGCGAGGCCAGCAA
CATGAAGCGCCGCAACGCGCTCAACAAGCCGCTGGAGCACGTCAAGATCCGCAACTACGACGACATCAACGAATACTTCTGGAAGCAGCACTGCCTGAGC
ATCCCCGTGTCGCAGGTGGGCCAGGAGCTCACGCAGAACCACGGCAAGACGTTCTACGAGCACCGCAGCCTCTTCACAATGGTGCTCAACTACTACCGCA
TCTTCCAGTTCAACATCATGTTTTTGGTGCTGCTTACGGTTCTGGCATTCGCCGTGACGATTTCTCCGGATGGAGGCAAGAGCGGCTGGGTGCAGTTCGG
CCGCATCGGAGACGTCGTGGAGCCCTACACGACCCGGGACTTGAAGATCGCCGTGGTCGGCATCCCCTTCAGTCTCAGTCTGATGGCGTTCCTCAAGTGT
GTGCTGGAGGTGTGTCACGGATGGCACTTGCTGATCTCCAAGGAGAGCTCGGCGACGAGTTCCAGGTCGTTCACGTACGGGTCGGCCCTGGCGACTCGTA
TCATCTGGAACGGAGGCTTTGCCGTGCTCTTTGGCATCATGATCTACGTGCCGATGAACGAGGACAAGGATACTACGCTTTTGGACAATTTGTACCCGCT
CTGCGGCGCGTACATCCTGCCGGGGCTGTTGGTGCTGCTGACGCAGGCGTTTGCCCCCCAGATGATCAACGGAACGTTTGCGGCCAAGTTTGTGCGTGAG
GGCGAGAGCTGCTACGTCGGTCAGGACATGACGCCCCCGTTCTCGTACCAGGTCAAGTACATTATCTTCTGGATCTTGCTGTGGATCCTGAAGGCCATCA
CGTCGTACTTTATCCTGGTGCGTCCGCTGATGCTGCCGACGCTGAGCATTTACGCCATGAAGCTGGACTACCAGAACTCGCTGGTGTCGTTCCACAACAT
TGGTATCATTATTGCTCTGTGGCTGCCTGTGGTGTTCATCTTCAACTACGCCACGCAGATCTACTTCACGATCTTCCAGGCGTTGCTCGGCGGATTCCAG
GGCATTCTCATGAAGACGGGCGAGATCCGCGGCGCCAAGGAGATGACCAAGGCCTTCCGCGTCGCCCCGCAGTTGTTCGACCAGAAGGTGGTGACGCTTC
TCGCTCGCTCTAGTGATGCGACGGCTAGCGGCACGGACTCCACGCGCGCCAGCGCCATTGCTGCCGCCTACGAATCGCAAATGATGCTGCGCTTCGTCGT
GGTCTGGAATGAGATCGTCAACTCATTCCGCGAGGGTGATCTGCTGGACGACAAGGAGGCGGCTATTCTCCAGTACGACATCCGCAGCACCGGCGAGGTG
TTCGAGCCTGTATTCCTGTCAGCCGGCAAGCTGACGGAGGCCATGAACCTCGCGATCAAGATGGCCAAGGACGGAAAGGGCGAGTCGCAGCTGCGCGTGG
CGCTCGTAGAAAACGACTGCCTCTCGGCTATCCGCTCGTTCTTCACGGCCAGCATGTATGTCGTGGGCGCTCTGTTCGGCAACGACGACGCCGATGTGAT
CGACGGCTTCCGTCAGATCGAGGAGATCGCCGCGAGCGGTGGTTTCCTGAAGTCGTTCAACGTGCGTGAGCTGGCCAGCCTTCGCGTGGCCGCCGTGGAC
CTGCTCGAAGAGATCCTGGACCTGCCGGACCCGGACGCTCAGTCTCAGCACATCCCCGACGCGCGCGTGCACTCGATGGGCGTGATTCGCAACTTCGTGT
CCAAGATGGAGGCGTTCCTCAACGGCGTGCAGTCGTTCTGCGTGGACCCTGCTCTTCAGCGCAGATTCGGCAACTCCAAGTTCTGCTCCAGCGCCAACGG
ATACATGTACGCGTCGCGCGGACTGGTGAACCTGTTCTGCAGTGACACGGCTATGGGCGCCGCTACGCGTGCGTGTCTGCTGCTGTCCCTGGACCGATCG
GAGGCCATGCCTCGCACGACCGAGGCCCAGCGTCGTCTCGGTTTCTTCATGAAGTCGCTTGTCATGGACATCCCGCAGCTGCGTTCCATCAAGGAGATGC
GCAGTTTCTCGGTCGTGACTCCGTTCTACGCCGAGACCGTGCTGTTCTCGCTTGAGGACCTGAACAACCCGCTCGTGAACCACCCGATCTTCCAGCAGGT
CGAGGAGGACGGCAAGAACCTGACGATCCTCAAGTACCTGACGAAGATTCACCAGGAGGAATGGGACAACTTCCTCGAGCGCGTTGACGTGAGCTCGGCG
GAGGAGGCCCAGAAGAACCACCCCGAGGAGATCCGTCTGTGGGCGTCGTACCGTGGTCAGACCCTGGCGCGTACCGTGCAGGGCATGATGATGTACGAGG
ATGCGATCAAGATTCTGCACTGGCTGGAGATCGGCTCGAGCCCCGGCAAGTCTGCGGAGCAGAAGCAGTCGCAGCTGCAGGACATGGTTCGTCTGAAATT
CTCGTACATTTGCGCCTGTCAGGTGTACGGCAAGCACCGCGCGGAGGGCAAGGCGCAGGCTGCGGACATTGACTACCTGCTGCGCGAGTATCCGAACCTG
CGTGTGGCGTACGTTGACACGGTGGTGCACGAGGATGGCGAGAAGTCGTTCGACACTGTGCTGATTAAGAGTGAGAACGACGATATTGTGGAAGTGTACC
GTTACTCTCTGCCTGGCGACCCGATCCTCGGTGAAGGTAAGCCCGAGAACCAGAACAACGCCATCCCCTTCACGCGCGGCGAGTTCGTCCAGACGATCGA
TATGAACCAGCAGCACTACTTTGAGGAGTGTCTGAAGATGCCGCAGCTTCTGTGCACGGCCGACCTGCACCCGTCGAAGAAGCCCGTGTCGATCATCGGT
ATGCGTGAGCACATTTTCACGGGTAACGCCAGTTCTCTCGCCAAGTTCAAGACGTGGCAGGAACTGGTGTTCGTGACGCTGTCGCAGCGTGTCCTGGCCG
AGCCGCTGTACGTGCGTATGCACTACGGTCACCCGGATGTGTTCGACAAGGTGCTGGCGATCACGCGCGGTGGTGTGTCGAAGGCCAGTAAGGGCATCAA
CCTGTCGGAGGATGTGTTCGCTGGTTTCAATACGACGCTGCGCGGCGGCGTCGTGACCCACGTGGAGTTCATGCAGTGTGGTAAGGGTCGTGATGTGGCT
CTGTCGCAGATCTCGATGTTTGAGGGCAAGCTGGCCAACGGTGCCGGTGAGACTTCGCTGGCTCGTGAGGCGCATCGCATGGGCCAGTTCATGGATTTCT
TCCGTCTGAACTCGATGTACTACTCGCACACGGGCTTCTACTACGCGACGTGGATGACGATTGTCACGACGTTCGTGTACATGTACTGCAAGGTCTACAT
CGCCCTGTCCGGCGTGCAGACGCAGATTGTGTACAACATGAACACGACGGAGATCATCATGGACAACTCGGAGACCTACGGCTTCGACGACCGCGTGTAC
CACGACATGGACTCGGTGTACAACACGCAGTATTACATCCAGGCTGGTCTGTTCCTGTCGCTGCCGCTGATTTGTGTGTACTTCGCTGAAATGGGTCTGC
GTCGCGGTCTGGTGCAGTTCTTGGAGATGGTGTTCACGGCTGGCCCAGCGTTCTTCATCTTCCAGCTGGGTACGACCATGCACTTTTTCGACAACAACCT
TCTGCACGGTGAGGCTCAGTACAAGGCTACGGGTCGTGGCTTCAAGATCACTCGTGAGACGTTCGTGCTGCTGTACAAGGCTTACGCCCTGAGTCACTAC
CGCAAGGCCATGGAGCTCATCGGTCTGTGTTTGGTGTACCTGACGTTCGGCAAGTTCGACATCTGTGACACCTCTGTTGCTGGTGAGGAGAACTCGTTCG
CGTTTGACTACTGTGAGACGTCGCAGAGCTTTGGTGTGCAGACGTTCGCTATTTGGGTTATTGCTATCGTGTGGCTGGTGTCTCCATACATTTTCAACAC
GGACGGACTTGACTGGGAGAAGACCAAGGCCGATGTGACGGCCTGGGCCAAGTGGATGTACGCCGCTGAGGACTACAAGGACGAGGACAAGGTCATGGTC
GGTGGATGGATCGCGTGGTGGAAGGGCGAGCTCAGCTTGTACCATAACACGAAGCCCGTCGCCCGATTCACGGTCATTCTGCGTGAAGCTCGCCACTTCC
TGCTCATGTGGTACGTGGTGGCGCTCGAGTGGGAAATCCTCTCGGTTGGCCTGGTGTTCGGTGCTGCTGTGGTCACGGTGCTCGCTATGGGCCTCTTCGG
TGCCGCGGGCAGCTGCTTCCGCAACGTGAACTCATCGATCCGTGCTGTCATGTACCTGTTCGTGGTACTGGTGGCCCTTATTGTGTTCTTTGTGGCCACT
ATCGTGATCTCGGACGTCAGCTTCACCCGTACCCTCTCGCTGTTCTTCGGCTACATGGCGGCTCTGTACGGCATCAACGAGATGGCTCGCATGTACAGCT
TTGCCAACTCGTCGATCGCGTCCGTGGGCATGTTCCAGCAGCTGGCCTTCTTCTTCGACTTCATCTTCTCGGTGGCTATGATCGTGCCGCTCCTCGTGAT
GTCTGCGATCCCGTTCCTGAACATTATTCAGACGCGTATGATGTACAACAAGGGCTTCTCGGAAGTCGTGTCGGCCTCGTCTCAGTACGCCTTCTCGCTC
GCGGCCTTCATGGGCATGTTGGGCGGTATTGGCTGCGGCTGGCTGTTCCACCTCTTCACTACGATTGAGAGCACTGCTGGCTTCCTGAGTTACGTCACGA
CCTACGACCTGCTCGACGGCAAGGTCGGCGACGGCGCGGTTACCTACGCGTTCTACTTCGCCTGCATCGTGGGCGTGTTCGTGTCTGGCTTCCTGAGCTA
CTTCATCGGCCGTCGTCTTTCTATCGTCTTCGGTGGCCTGCTGACTGTCCTGGGTATGCTCGGCGTGAGTGCTGTCCAGAGCGGCGGTGAAGGCTTCCTG
ATGCCTGGTATTTGTCTGCTCGGTGGCTCTGTCGGTGTGCTTCTGCCTACGCTGGCCGTGTACATCTACGAGATCTCCACTCGTGACATGCGCGGCAAGG
CCCTGCTGCTTCTTGGCAGTGGCTTCATTCTTGGCGTCCTGTTCGCCTCGTGGTTCTCTTCGTCGTCGAACGAGGTTGGCTGGGTGTGGCAGGTGTTCAT
CGCGACCATCATCCTGTCGATCATGACTCCGGCGGTGTACATCTTCCCGGAGAGCCCGTACTGGGTGTACATGCGCGAGGGTCTGGAATCGTGCGAGCGT
TGTCTGGCTGTGCTGCGTCGAAAGGAGGGCGTGTCGGAGGAGCTGCGCATGATCCGCGACGAAGAGGCTGGCAGTGACGACTCGAGCGCCAACGGCGGCA
CTTCGTTCCTCAAGTTCGTGATGGGTCTGTTCCTGATGCTGGTCTCGGGTATCTTCCTGGGCTGCGTCAACATGTACCTGTCGGACACGTTCCGCAGCAT
CGAGGACGCGACCTACATGTTCGTGAACTGCACGGGTCTGCAGTTCCTGGGCGCGCTCTTCTCGTTCTTCTTCATGGACCGCATCGACCACAAGCGCATC
CTGTTCTGCACGCTGCTGCCGATGGCCGGTCTGGTGTTCGTGCTCGGCCTGAACAACAAGTCGGAGTTCGTGACGGGCGACAGCGAATACCTGATGCTGC
AGATCGTGGGTCTGCTGCTCTACTTCTTCGCCGGCCTGGGCATCACGTCGGTGCCCTGGGTGTCGTGCGTCGGTCTGTTCACCACTAAGCAGCGCGCGGT
GTACGTGACCGTCTACTTCATGGTCTTCTTCCTGCTGCCCGTGTGCTCGACGTACATCCGCTCGAACGACTCGATGAGCGGCGACGAGTACTTCTACCTC
TTCGCCCTGACCGGCTGCTGCGTGGTGGCGATGGGCCTGCTGTTCACAGTGGGCACGCTTAAGAACGGCATGGTGTGCACCAAGGGCGAGATGGAGGCGG
AGCGCGCGCGCCTGCGCCGCATCCGCGCGTCTCGGCGCAGCGCCCGCACGCCTGGCAGCGCGCGCTCAAGAAACTTCAGCCGCTCGCGCGCCAAGTCGCA
CTCGAACTATCAGATGTACGAGTCGCCCGCTGGCAGCGCACC