Description :
From Genome Similarity Track
Location :
scaffold_886:3338- 7691
Transcript NameFunction/comments
g10547.t1hypothetical protein

Sequence
4353 bases(100 bases per row)
GTTTTTTGCACGAGGCCCTATCTGATTGGATAAAACGGCGCCGACTGTACACGAAGAAGTTGAAAGAGCGATGCCGTGTGACTGGAGAACCTATGCCAAC
ATTGTCCAGTCGATTCGTAATTCGGTGGACCCTGACTTACTTGAGAGCATATGCGAACTTCGGCTGAATACAAGAGCTGCGGGAGTGACGGATGCTATGC
TGATCACGGAGATCAATCGTATCACTACCAGCGTGAAAAACGATGCTTTGCCTGATGTGAAGGCGTTGTTCCAGTCAAAGCTGAGGATGAACATGACGGA
GAGTGATGTTGAGGCACGAGTACTGGATTATTTCAACCAATTGAGGAAGATAGTCCGAGAGAACGGTTTACCATCGTTTTTCGAAGGCGACGGAGATGAT
GCTGAGAAGTGTAAACGGCCCGTGTCCTCGCTTCATCCCGTAGCGTTGAAGGACGAGGTGGAGCAGTGCCTCCAGTATACTCACAAGCAGGCGGCGACGA
CCCCAAGGCTACTATTCGAACTTGTTACTGAAAAGGCAAAGGAGCACGAGCGTCAGTACCAGCGACTGAAGAACAGAAAACGAGAGCGAGAACCTGCTAC
TCAGAAGAAGAAGCCGAAGCCTCAAGGCAGGACCAAGCCGGAGGCAACTGAGACGAGCGAAGCAACACGGAAGGTGGTCAGTAGCGACAGTAAAGCGACC
CCGAAGACCAAGGGGAAGGCTAAGGGGAAGTCGAGCAAACTGCCTCCAAGTCCATGTCTGAAATGCGAGGAAATGCATTGGCTCAATGAGTGTCCATCTG
CCACTGAAGAAGAGAAGGTGGAGCTACGCAAGCGCTTGCGAGAGGCGAACGCGGCCAAGCGTGCGAAGACAAAACGCCTTGGAGAACTCCTGCCGAGTCC
TGAGCGAATGGTTACTGTGAATGGAGTGCTAGAGACCCCGTATTGCCCGGACAGTGGGTCCGACTATACCGTGATGGGCCGATCGCATTGGGAACAGCTT
CGGTCCCTCGACCCAAGCGTACAAGCTGAAAAACTTGATGTCCCTGTGCGGAACCAGACATTTGGAGCTGCACAGGTGATCGCTGAAGAGAAGGCGAAGC
TTCATTTGATGATCCGAACTGCGGCTGGACCGGTGGAACCGATGAAGGCTGTGGATATGTTGATTGTCGACATGAATGATGACGAGTTGATCATTGGTAA
CGACTTGCTGGTGGCTTTGGGTATTGACGTGGAGCATCAGCTAGAACAGCTTGCAGACCGTGGAGAAGATGAAACCAGCGGTGATGCCATTGACTTAGAA
GCTAATGAGCCTCCTGTAAGACTTGACGATCCTAAACCTGAAGATGATGAAGTGTTTGCAGCTGTGGAACGCCTAGTGGAACAAGCTTTGAAGAACGGAT
TTCCCGAAGACAAAGTTAAGCGGCTCCGCACGATCATCCATGCTTATGACGTGTGGCGTCTGGCACTGCAAGCTGACCCGCCAGCACGCGTTCCACCGAT
GGAGATGCATCTACGAGACGGGGCTCGCCCAACGAAATGTAAGCCCCGCCGGTATCCTCCTCACATTCGGAAGTTTCTTCATGATTTTAACTCTCGTTTG
GTGGAACTAGGACTGGTCTATGAGAACGCCAATAGTCGGTGGGCGAGCCCTGTCCTACCGGTTAAAAAATCTGCAGAAATTATGGATCTCCGCCAGACTA
CTGATTACCGAGAAGTAAATGCATTGACCGAGGTGATGGTGGCAGTCATGCCCATTTTGTCCGTAGTTTTGGAAAACGCGAAAGGAATGGAACATTTCGG
ACTTTTTGACTTTTTGAAAGGATTTTGGCAACTTCCGTTGGCTTTGATGTGTCAAGAAATTCTATCGTACATGACCGACGAGAAGGTGTTTACTCCCCTC
AGAGTCCCTCAGGGTTGCAGTGACGCAGCGGTTTTCTTTCAGAAGACTATGGAAACCTGCTTTGCTCCCCTGTTATATGAACATTTGCTGATCTGGATCG
ATGACCTACTATTATATGCCAAAACTATTGAGGAATACCTGGACAAGCTGGATGAACTCCTGTCACTAATGGATCATTGTGGACTAAGTTGAGTGCAAAG
AAGACCTCCTTGTACCAGACCAAAGTCAAGTGGTGTGGCCGGATAATTAGTGGGGAAGGGATCGAACATGACCCTTACCGAATTGACTCTTTACGGGCAT
TGCCTTACCCACGAACGGCTGGAGAACTGCAGCAATTTGTATGTGCAGTGAACTGGATGCGACAGAGTATCATTGATTTTGCAAGGCAGATAGCTCCTCT
ACAGCAGAGACTCGATACCGCCCTCGCAAAAACGAAGAGAACTAAGCGGGTGGCTGCAGGTATTGAGATTCAGCTTACCAGTGAGGAACGTAAAGCATTT
GACCAAGTCAAGGGCGCGCTCACCACAGCAGCTACGCTAGATATTCCGGATGATGCGGCTGCTACGTGCCTGTTTACAGATGCGTCTGACATGGGATATG
CGATTATCGTGACGCAAGTTGCGGACTTTGACCCTCGGAAACTGGCAACGGAGCAACAACATCGGCTTATTCACTGCACTAGTGGAACATTTGCAGGCAG
CCAGTTGAACTGGACGGTTGTTGAAATAGAAGCGTTCCCCATAGTTGATGCGTGTGACAAGCTCGACTACCTGTTACTGAGACCACGGCCATTTCGGATG
TACTGTGATCATCGAAATTTGATTCACATATTTGCACCGAATGCGTTGATCAAGAAACATGTCAAAGGGAAGCTGGTACGATGGGCCTTGAAGTTAATGA
ACTACCAGTATGTGGTTGAACACGTGCCTGGATCTGATAACGTCTGGGCAGATATGATCTCTCCTTGGGGAGGCAACTACACGCCGTCTATCAAGCGATT
AAAGACAGTGTGATCACGCCCCAACCAAATCGGGCCATCTGTGCCTGTTCTAAGACCCCTGGATGATGACCATTTCGTTTGGCCCACTCTCGCAGAACTT
AAGGAATCCCAAGATAGACACACTTACCCTAGTCACGCCAGCAAAGATGCAGAGGGCCTAGTGGAGATAGACGGCAAATTGTGGATCCCGTACGAAGAAG
ACGATTTACTGCAGAGACTCTGTGTCATCGCACACTGTGGTGCCCAAGGACATCGAGAACAGCAGGCTATGGCCGCTCACTTGGGCAGGATTTTCGCCAT
TGAACACCTCTCTGAGGTGGTAGAAAGATTCGTCAATCACTGCCTGCTATGTCTGCATTTGAGAGGGGGGGGGGGGGAAGATTATCCCACGCCCGTGGAG
CGAGGTGATTGACTGCCGTACGCGTAATGGTGTTCTTCATTTTGATTTTCTTTACATGGGCGAAAGCTATGGAGAAAGCAAGTATCTTCTGGTTCTTAAG
GACCACGCCACACATTACTGCGAGTTGGTAGTAGCAGACTCAGCTAAAAGCAGTGTTGTGGTTGAAGCCTTGTTAGCATGGCACTCACGTTCCGGTGTTC
CTCCCGAATGGGTCTCCGATTGTGGAACTCATTTTAAGAATGAGATCGTCGCTGAGCTGAGTTGCCGCCTCCGATCGAAGCAGTCGTTCACGCTCGCCTA
CAGTCCATGGATAAATGGATCCGTGGAGAGGGTAAACCGCGATGTTCTACAAGTGGTAAGGGCGATGATATTGTCCTACAAGATTGGATATATAGACTGG
GTGTATCTGGTACCGATGGTGCAGGCAAATCTTAATCACACCGCAGTGCCGTCGTTGGGTAACCGGGCTCCCGTGGAATTATTCACTGGACTGCAGTGTC
CTACCCCACTTCGAGAGTTCTATTTGACGATCTACAGCAAGTTCCGCAGAGCGAGCTGATTGATGGCTATTTGGATCAACTTCGTAGCAGATTGCGAGAG
ACGCATGGAGTTGTGAAAAACAAGCGGCTCAAGCAGAGATTGTTAAACAAGAAAAAGGAAAGAGGTGAAAATTTGGTTAATCTCCATATTGGTGACTACG
TCTTGCGATCGAGGATGGACGAAAAGCGTGGGAACAAACTTTAAGTGACTTGGATTGGGCCATATCGGATTATTCGAGCCGATTCGCATTCATTTCGGGT
TCAGCATTTAATAATTGGTGAAGTGCAGGATGTGCACCCCTCACGGCTTAAGATGTATGCGGATAGTAGTCTAAACGTGACGGACGAATTACTCGAACAT
GTAGCCTCGCAAGGAATTGTCCTGGCTGTAGAAGAGTTGAAGGACCACAAGTGGAACGAAAGGACGAAGGATTTCGAGATATTGGTAAGCTGGAAGGGCC
TCCAGGATATCGAAGATTTCTACGAACCAATGAAGGACCTGGCCAAGGACATT