Description :
From Genome Similarity Track
Location :
Scaffold_466:3338- 5397
Transcript NameFunction/comments
Physo_125881gag protein

Sequence
2059 bases(100 bases per row)
TATACTCGGAGGCCCGAGTATAATAACTCTAATTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAG
GCCCATTACACCTGGATGCACTTTGTAGTCCGTCCAACGACCGACTACCTGAGCTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGAT
ACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCCGTCGGATCCAGAGTGGGAGGCCCTCCAACGAC
TGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTAACACCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCA
ACGCGATGTTGCTACTACTTCCGCGGTGTCGTCCGGGACGACACAACGCGCGCAATCGCTGAAGCTCAATGTGAGCAACTATGTCGGAAGAGAGGGTGAA
CCTCTCCTCCGTTGGCTTGTCGAACTCGACACAGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGACG
GACGCGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGACCCTACGTGCTTTAGCACGTACGAAGGTTTCAAGGATGAGCTCAGACGAGCGTTTGAGCC
ACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCG
AACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGGCTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACC
CAAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCC
GGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTGCTGGACCCCATCAGTCGCAGGGAAACAATGTGCGATGCTACGTTGCG
GTGGAGTCGGTCACTTTGCTCGGAAGTGCACGGCTCCCGTGCACCAGCAGGGTGGCTATCGCGGGCACCGTCGCAACCAAACAAAAAAACGCTGGACGCC
AGTAGGCGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTAGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGATTCAGTCTCGCTGC
AAGAACCAAGATGACAAGCCTAACCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAACGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGA
ACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAA
GACCGAGAAGCACATGGTACGCGTGCGCTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGAACGATAAGTTTGACATTGTA
TTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACACAATACCTGTTTCT
TGTAAACTTTTTTCATCGCCCTGCTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGACCGC
CCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCAAGCGTCGGCATCGCCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCT
TTTCAGCGAATCAGGAAGAGTCTCCGACCTCAAGGGGCACGGATGACGCAGACGAGTCACACGCCTCAACCGTGGAGGCTGACGCGAATCTGATTGGATC
AGGTCTGGCCAATAATAAGAGCCAAGGTAACGTAACGCCGTCGACTCCGGGAGTCGATG