Description :
From Genome Similarity Track
Location :
Scaffold_13:33375- 34955
Transcript NameFunction/comments
Phyke_g919hypothetical protein

Sequence
1580 bases(100 bases per row)
TGCTCTTCCTTGAAGCTTAATTAACTTACGTTAAGCATCGCCGTGAGTTCTAAATGACCACCTTGAGCTGCCCGAGGtacccacagcaacaacgaccCAC
CACCCGTACCGGGAAGACCCAGAAAACCAGGCCGCCACCGGTCCAGGTACAATGTCTTGCCTCCCAGTGCCGTCACATTCGACGTCCACGTCACCGTCTC
GCCTGCAGCAACGTTTACCTTGTCGAACTTGTTGCCACCGGATTTAATGTTCACGGTCACATCTTCCGTATCGACGCTTTGGAAAGTAATGGTGAcaatg
ccatcgccaaccTTGGTCCAGGTACCAACACTGTTGGTGAACGCATCCTGTACGGTTTTAAGACCTAGTGCCTTGCCGGCGCTACCGTCATCGATTTCAC
CAATAAACTGTGTGGGTCCGCAAATGGTCTGGAAATACTCGGAAACTACACCGGCGATATTTGTCACATCCCACACCGCGTAAAAGGTGAGAGCTTTGTC
AGCGATCTTGTAAGCGTACTCCTCGGCAGTGAGAAAtgtgccattgctgctagTTCCGGAACTGATGAGATCGTCCACGATACCCCCAAAGGTTTTACGT
AGATTATCACGAATAGAATACGCCGTGGATGTGTCAGATTCAACGACCAACTCCTCCATGCAGTTATTCGTGACAATAGGAATCTCATTTAGCACAAGGT
TTGACTCACTCATTATCACACGAATGTCGTCCTCTGAAATATCAGGCTTTTGCTTGCGGAGATCTAACACGGTCATCCAGGTGCGGTCAAGAAGTCGTTT
CATGTCGTATCCGCAGGATGAGTTGGATTCCAGCGAAGACTGCAGCGAAGAAATATCCGTCTCGTTTAGCGAACTAATTGAATCGCCGAGAGTGATGTTC
GTCATGAACGTCTCGAACGTTTCCCAACTGGAAACGATTGTAGCTCCGTTTGATATGATTTCTTTTAGAGCAAGCTCAGCAGTGTTCAACACTCTGTCAG
CAAACTTGACATTGTCCGGCACTTTAATCCCAAGGCATGAGGCAATAGTCACGGGTACATCGAAAACCACGTTGTCGGTCTGGTACAGCATCGTCAGCAA
CTTATCTTGAGTAGTCTGTGGATCTGATACCTGGACTGCACGAATGTATTTTGATAGTGACTTCACCAAACCCATCATCTCTTTTCCGCATTTAATCGCG
GTTTGGAGACCTTTAGCCATCAACTTGAACTCGCCGTACAAACCAAATGTAGCGAGTGATAATGCCGACTGAGCTACGACTGAGATCTTGGTCACGACTT
CGAGTGCACAGTCATCGTTCTGCCTGATGCACTCCAAACCACATGCAACGGGATACGAAAATGAGCATTGAGCCCAGCACGTCTCAACGTTGCTGTCGAA
TCCCAGAGGACACGTCTTCGCGATGTGCGCCTCACGGTAGCACGCAGAGTCGGAGGCAGTGCCAAGGGCTGAGCCAATCCAATTGATATAAGTCGACTCG
ATCGTGCTGGTGGCATTAGTGACGCTGTCTATTGTAAACTCCGATGTTATAGACTCTTCTGATGCCGCTGATCCGATTGT