Description :
From Genome Similarity Track
Location :
Scaffold_1308:3337- 6088
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1308-abinit-gene-0.11Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_1308-fgenesh-gene-0.2Poly-glutamine tract-binding protein

Sequence
2751 bases(100 bases per row)
TCGAATGCTATGACCGTTGGAATAGCAGCTTCGCGGACTGAAGATACTGGATCATGCCTCCCACATACAACAAGGTTTCGAACACGCTCCTGTAGCAAGC
ATGCAAATAAAAAACACATGTGAAAGCTTGCTCACTACCATTGTAAGCCACGTTTTGGTAGCGCTCGCTTTGCCACGTACCAGATGAAGTTGGAAATACT
CTTTCGTAGATTCAGCGATAGCGTCGTCACTTAATGCGAAATATTCGAGCAGCATCGTCAGCAGCTCGATGCCTCGTTTCCGCAGCACCCAGTCTTCTCG
TGGCGCATACTGGAAGACGTCCTCGATGGCTTCAAAGATGAAACCCGCATAGGGCACAATACACGCAAAGAGCTCTTTGAAGCCGCATCTTGAGTTGACC
TCATGCGCGAGCTGGCAAGCGGATTGCAGCAACAAGAAAACGGGTGAGAATGAGGCATACATCGTACTCCCGTTCATCTTGGCCACAGATGCACTCAGGA
TGCTCTTGAAGAACGAATGAACCCGAGTTGCATGCGCCAGCAAGATTTCATCTGATGGCAGAGTGTGTCCATCAAATTCCGTCGGCCGTATCACGCTACA
CAAGCATTTCGTCGCATTCTCACCAACGGCATTGGAGTCTTTGAGCAGTGGCGCAGCCACAGTCTCGAACACTTGAAGCCAGATATCATCACCATGAACT
TGAATCCCATTAGCGTCGCCTGAAGTCGAGTCGTCAGTAGTATTGGTTGGAACACTATGAACTGGGACGATATGAAGGACAACAGACGACACGAGGGTCT
CGCATGCTTCAGTGACTTTGCTCTCATTGTCGCGCAAGCGAATGCTAACGTACGCGAGAATCCTCGATAGAAGCTTTGACGATTGCAGTGGATGGCATTT
GCAGAGCACGGCCATCAGCAAAACAAGCATTCGTCGCGTTGACGATCGTGGTGGACTCTGCAACATATCAAGTTCACTGGTTAGGGACGAAAGGCTTGCA
ACAGGGTGAGCAGATCCTCAGAGGTACCTTGTTTTTCTCGATAAGAGTGTAAAAATCTTGTGCGAGTGTCGAATCCAAGCCAGGAAGGCATTCTCTGCGC
ACAAGAAAAAGAACTGAGTTCAGATGACCAAACGAACGAGTCGTTCTATGGAAAATACTTAAGCCACGCAGGAGTTTGTTCTTCTCACATGAGAGACTGG
AAAGCTTGCTGCTGTGTATCCCGATCCTCAAGTTTGCCGACTTTGTCGCTGAGCTCTCGCAGCGTCTGCAGCAGTTTCTCTTTCGCCTTGCGCTCAATTT
TTTTCTTCTTGACGCTTCCAACTGACTGATTGTTGTTTCCTCCAGCTGCTGGCTTGCTGGGGCTTGATATGTCGAAGCTGCTGCTGCTACGTGTGGCCGT
CTTCATTGGCACGTCTGTAGCTTTTTACTTCCTCTTAAAGCAACGACACTCGCTTCCAGCGTGCGCGGACTGTCATGAATGATATATAAATATCCCATGT
ATCTTGACAGACTCCTGAAATATAAGCATGTCTATTTGAAGGTAATACAAACCTTGCCACTCTCTTATCCCCTCGCCTTCCTTGAATCTCATGGACACAG
TACAGGAGTTCTCATGCTGCATGCTCCCAAAGTCACTGGCCACATATCAATCCCCAACGCTTCAGTCAGTTGTTTTCAGGATCGAGAGGATCACGCGGTC
CGCGCTGCTGATAGCGTTTCTTGTGGCTCTGCGCGGACCGTGAGCGGTCAGAATTCCCAGCAACGTCCCGCGATCGCTTGCTACTTTGACTCCCCACGCT
CGGCCCACAGCTCTTGAGGATGTCATCCAGCTTGGATTTCGCAGCCATTGCTTCTTCTACGAGTAATAATACCATAACAATAACAAATCCAGCACATAGT
AAGCAGTGGGATAGTAACGCTGGAGACTGGGGACGATCCTTACTTAACGATACTTTCGTGGACACCGGACGCGTCCACGTGGTCTCATTGGTGTTTCGAT
TCCAGTAGTACACGTCACCACTGTGAGAATCTGTCACGGGTTCCCAGTCACTACACACAACCAACATGCATAGGCAGTGCTCCGCCGTGTTAGAATGGAT
TACACCTAAGGCGACAGCGTCAATATGTCGTAAAACCAGATTTCCACGCACTCTGGCAGTGGCTCGTCAAACTTGGTGGCATCAGTCTGCTGTGGAGCTT
TTCCTGTCTGTAGCATCAATACAATTGAAATATAGTAAAAGGCAGTGGTGCGAGTTCATGCACTGTGTATGGCGTACCTCACGATGCCCAGGATGGTCCC
ACGACGTTTCTTGTGTTTTCTAAGCACATACACACAGAGAGACAATGGGACAACAGATGACATCACCGCCACCACCGATCATGGCATTAATTTACTATAC
TTCGCATGTCATACACAATCAGGCAATAGATTAGAAACTTGGCACTCACTTCGTTCCAGTAGTAAGTATCGCCCGATGTTGGGTCTTTGGCTTCGTTCCA
TCCATCGGGCAGCGAAGTGTCCACTGCTGAGCCGCTGCTGTCTCCATGCGGACGTCCCGGTCGGAACGCGTTCACCTGCTGTGCGATCGTCTGTGTCTGA
TGGATCTCGTTCGCGCGTCGCATCGCGACCACATGCAGCGTGTTGTCTCTCACGCGTGGATCATACTTGTCCGCTGCGGTCTGCTGCTGCGGGGCGCCAT
TCACGAAGCGCTGAACCTTTGCGGACGTCGCGCTCACCAGCTTCTGGCGCT