Description :
From Genome Similarity Track
Location :
Scaffold_450:3337- 5445
Transcript NameFunction/comments
Physo_145074putative polyprotein

Sequence
2108 bases(100 bases per row)
AACAAAGATCGGGCAGATTACGTATTTACGGGACGCGCTGTCGCGCAGGCCGGATTATGAGCTGGCTTATATAACGACCGTGACTTCGTCATTACCGGAT
CTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCGCGCTGCTGAAGGCTCTGGGGAGCAAGGAGTGTCAAGACTCGGACATGAAATTGTCAGCGC
GGCTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGTTGTTCTACAACACTGGCCCCGAGGATACGCCCCGCGTGGTCATCCCTCATGATGC
GGATCTGAAGTACCGCATCCTCTACGAGGCACACGACACGCCGCTGGCCGGTCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTATTGG
TGGCCGGAGCTGTACAAGTGGACGAACATTTATGTGCGCACGTGTGAGACGTGTCAGCGAGTGAAGTCGTCACCTCATGCTGCAGCGCCGTTGGCGAGTT
TACCTGTCCCTTCGGGCTGCTGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGCGGACGCGGCGGGCAACACTGGAGTCGTGGTCTTCGTGGA
CCGACTACTCACATTGCGGCTGTGCCGGATACCATCGATGGTAAAGGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGT
CGATTGTCTCGGACCGAGACCTCCGCTTCATGGGCAACTTCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCC
GCAGACCGATGGTCAGGCCGAGCGCGTAAATCGCGTCGTCGAGGACGTGCTCCGCAGCATTTGCGCTGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCA
CTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTACGTGAACAGCTTGTCTCATCCCCGCGTCCCGCTGACGCCGC
CACGTGGTGACCTCGGGCTTGGTGGGGGAGGAGAAGCCGACTTAGCTGATCGGCTAGCCGATGTCAGCCCGGCTACTGTTCGTAAACAGGTTGACGCTTT
CTTGTCGACGCGTCTGAGTGTCTTACGACATGTGCGTGATGCAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGAGCAGAGGCAAT
GTTGAAAGTTATGAGGTTGGGGACCTGGTGTTGCTTAATGCTAAGAACCTACCTACACATGCAGTGTCTGCCGTCTTCAAGACGAAGTTGCGCCCGCGCT
TCATCGGACCTTTCAAGGTTGTGGCCAAGAAGTGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCT
CAAGCCGTACCAGGACCCGATGCAGGTGCAGAAGGAGGCACCGAGAGTGACGAGGTCACAGGCGCGGAGGTCGCGGTCGTCGAGGACGAGACCATCCACA
CGGGCACCGCAGGTACAGGCGGAAGAATCGGCGCCGGAGGTGCCGCGGGCACAGCGAGAGCCGCAGGCCAGGAGTCGCGGCAGTCGGAGCCTGCATGCGG
GCCAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCTGACGCTGTAGCTCCCCGAGCGCCCGGCCACGTTGCTCATCGCGATCGCGATAGTATCGTACCC
AGTCCTCCAGGGCCCCAAGGCGGTTCCAGACCGCTCGAGGCACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGGACCAG
ACGTGCATCGACGTCATGGATATGATCCCGAAGGGGGCCCGCCTGCTGCCGCACCTCCAAGAGCTCACTTTGAGTCGCGAAGGACCCCACAGCGGCCTCC
ACCGGCCCTGCTCGATGAGCATGGGAATCTACATTACCATGTGGAGCGCCTCCTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCTGGTGAAATGG
CGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGACTGCCCAGACGTCGTGGACACTTTTGATCAGCTTCATCACCAGC
GCCCTGAG